CRISPR

CRISPR1-dab2

ID
ZDB-CRISPR-160331-1
Name
CRISPR1-dab2
Previous Names
None
Target
Sequence
5' - GGTGATTGAGCATGAACATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-dab2
No data available
Phenotype
Phenotype resulting from CRISPR1-dab2
Phenotype Fish Figures
atrium cardiac muscle cell decreased amount, abnormal f2Tg/+ + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
cardiac ventricle cardiac muscle cell decreased amount, abnormal f2Tg/+ + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
forebrain mCherry expression increased amount, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
hindbrain mCherry expression increased amount, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
midbrain mCherry expression increased amount, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
post-vent vasculature vasculature development decreased process quality, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
pronephros anterior region mCherry expression increased amount, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
vasculature posterior region mCherry expression increased amount, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
whole organism dab2 expression decreased amount, abnormal AB + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
whole organism tcf7l1a expression increased amount, abnormal AB + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
whole organism axin2 expression increased amount, abnormal AB + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
whole organism tcf3b expression increased amount, abnormal AB + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
Phenotype of all Fish created by or utilizing CRISPR1-dab2
Phenotype Fish Conditions Figures
whole organism dab2 expression decreased amount, abnormal AB + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
whole organism tcf7l1a expression increased amount, abnormal AB + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
whole organism tcf3b expression increased amount, abnormal AB + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
whole organism axin2 expression increased amount, abnormal AB + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
atrium cardiac muscle cell decreased amount, abnormal f2Tg/+ + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
cardiac ventricle cardiac muscle cell decreased amount, abnormal f2Tg/+ + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
midbrain mCherry expression increased amount, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
forebrain mCherry expression increased amount, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
hindbrain mCherry expression increased amount, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
pronephros anterior region mCherry expression increased amount, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
post-vent vasculature vasculature development decreased process quality, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
vasculature posterior region mCherry expression increased amount, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
heart physical object quality, abnormal f2Tg/+; w32Tg/+ + CRISPR1-dab2 control Fig. 4 with image from Hofsteen et al., 2016
heart physical object quality, ameliorated f2Tg/+; w32Tg/+ + CRISPR1-dab2 heat shock Fig. 4 with image from Hofsteen et al., 2016
whole organism malformed, abnormal f2Tg/+; w32Tg/+ + CRISPR1-dab2 control Fig. 4 with image from Hofsteen et al., 2016
whole organism morphology, ameliorated f2Tg/+; w32Tg/+ + CRISPR1-dab2 heat shock Fig. 4 with image from Hofsteen et al., 2016
cardiac muscle cell decreased amount, abnormal f2Tg/+; w32Tg/+ + CRISPR1-dab2 control Fig. 4 with image from Hofsteen et al., 2016
cardiac muscle cell amount, ameliorated f2Tg/+; w32Tg/+ + CRISPR1-dab2 heat shock Fig. 4 with image from Hofsteen et al., 2016
Citations