CRISPR

CRISPR1-amer1

ID
ZDB-CRISPR-160729-16
Name
CRISPR1-amer1
Previous Names
  • Z001418 (1)
Target
Sequence
5' - GGAGATCGCCACAAGATGTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf4147 amer1
Expression
Gene expression in Wild Types + CRISPR1-amer1
No data available
Phenotype
Phenotype resulting from CRISPR1-amer1
Phenotype Fish Figures
ceratohyal cartilage disorganized, abnormal ba2Tg + CRISPR1-amer1 (TU) Figure 4 with image from Sun et al., 2024
chondroblast col2a1a expression decreased distribution, abnormal TU + CRISPR1-amer1 Figure 7 with image from Sun et al., 2024
chondroblast sox9a expression increased distribution, abnormal TU + CRISPR1-amer1 Figure 7 with image from Sun et al., 2024
cranial cartilage malformed, abnormal TU + CRISPR1-amer1 Figure 9 with image from Sun et al., 2024
cranial cartilage chondrocyte disorganized, abnormal ba2Tg + CRISPR1-amer1 (TU) Figure 4 with image from Sun et al., 2024
cranial cartilage chondrocyte swollen, abnormal ba2Tg + CRISPR1-amer1 (TU) Figure 4 with image from Sun et al., 2024
cranial neural crest cell Ab47-h3 labeling decreased distribution, abnormal ba2Tg + CRISPR1-amer1 (TU) Figure 6 with image from Sun et al., 2024
cranial neural crest cell apoptotic process increased process quality, abnormal ba2Tg + CRISPR1-amer1 (TU) Figure 6 with image from Sun et al., 2024
cranial neural crest cell cell population proliferation decreased process quality, abnormal ba2Tg + CRISPR1-amer1 (TU) Figure 6 with image from Sun et al., 2024
Meckel's cartilage disorganized, abnormal ba2Tg + CRISPR1-amer1 (TU) Figure 4 with image from Sun et al., 2024
Meckel's cartilage malformed, abnormal TU + CRISPR1-amer1 Figure 4 with image from Sun et al., 2024
palatoquadrate cartilage disorganized, abnormal ba2Tg + CRISPR1-amer1 (TU) Figure 4 with image from Sun et al., 2024
palatoquadrate cartilage malformed, abnormal TU + CRISPR1-amer1 Figure 4 with image from Sun et al., 2024
pharyngeal arch barx1 expression decreased distribution, abnormal TU + CRISPR1-amer1 Figure 7 with image from Sun et al., 2024
pharyngeal arch jun expression increased distribution, abnormal TU + CRISPR1-amer1 Figure 8 with image from Sun et al., 2024
pharyngeal arch lef1 expression increased distribution, abnormal TU + CRISPR1-amer1 Figure 8 with image from Sun et al., 2024
swim bladder uninflated, abnormal TU + CRISPR1-amer1 Figure 3 with image from Sun et al., 2024
ventral mandibular arch malformed, abnormal TU + CRISPR1-amer1 Figure 3 with image from Sun et al., 2024
whole organism fosl1a expression increased amount, abnormal TU + CRISPR1-amer1 Figure 8 with image,  Figure 10 with image from Sun et al., 2024
whole organism ab1-ctnnb labeling increased amount, abnormal TU + CRISPR1-amer1 Figure 8 with image,  Figure 10 with image from Sun et al., 2024
whole organism lef1 expression increased amount, abnormal TU + CRISPR1-amer1 Figure 8 with image,  Figure 10 with image from Sun et al., 2024
whole organism jun expression increased amount, abnormal TU + CRISPR1-amer1 Figure 8 with image,  Figure 10 with image from Sun et al., 2024
Phenotype of all Fish created by or utilizing CRISPR1-amer1
Phenotype Fish Conditions Figures
chondroblast col2a1a expression decreased distribution, abnormal TU + CRISPR1-amer1 control Figure 7 with image from Sun et al., 2024
whole organism fosl1a expression increased amount, abnormal TU + CRISPR1-amer1 control Figure 8 with image,  Figure 10 with image from Sun et al., 2024
whole organism jun expression amount, ameliorated TU + CRISPR1-amer1 chemical treatment by environment: IWR-1-endo Figure 10 with image from Sun et al., 2024
cranial cartilage morphology, ameliorated TU + CRISPR1-amer1 chemical treatment by environment: IWR-1-endo Figure 9 with image from Sun et al., 2024
pharyngeal arch jun expression increased distribution, abnormal TU + CRISPR1-amer1 control Figure 8 with image from Sun et al., 2024
pharyngeal arch barx1 expression decreased distribution, abnormal TU + CRISPR1-amer1 control Figure 7 with image from Sun et al., 2024
chondroblast sox9a expression increased distribution, abnormal TU + CRISPR1-amer1 control Figure 7 with image from Sun et al., 2024
cranial cartilage malformed, abnormal TU + CRISPR1-amer1 control Figure 9 with image from Sun et al., 2024
palatoquadrate cartilage malformed, abnormal TU + CRISPR1-amer1 control Figure 4 with image from Sun et al., 2024
whole organism lef1 expression amount, ameliorated TU + CRISPR1-amer1 chemical treatment by environment: IWR-1-endo Figure 10 with image from Sun et al., 2024
swim bladder uninflated, abnormal TU + CRISPR1-amer1 control Figure 3 with image from Sun et al., 2024
whole organism fosl1a expression amount, ameliorated TU + CRISPR1-amer1 chemical treatment by environment: IWR-1-endo Figure 10 with image from Sun et al., 2024
whole organism ab1-ctnnb labeling increased amount, abnormal TU + CRISPR1-amer1 control Figure 8 with image,  Figure 10 with image from Sun et al., 2024
Meckel's cartilage malformed, abnormal TU + CRISPR1-amer1 control Figure 4 with image from Sun et al., 2024
ventral mandibular arch malformed, abnormal TU + CRISPR1-amer1 control Figure 3 with image from Sun et al., 2024
whole organism lef1 expression increased amount, abnormal TU + CRISPR1-amer1 control Figure 8 with image,  Figure 10 with image from Sun et al., 2024
chondrocyte nucleus ab1-ctnnb labeling position, ameliorated TU + CRISPR1-amer1 chemical treatment by environment: IWR-1-endo Figure 10 with image from Sun et al., 2024
whole organism jun expression increased amount, abnormal TU + CRISPR1-amer1 control Figure 8 with image,  Figure 10 with image from Sun et al., 2024
pharyngeal arch lef1 expression increased distribution, abnormal TU + CRISPR1-amer1 control Figure 8 with image from Sun et al., 2024
whole organism ab1-ctnnb labeling amount, ameliorated TU + CRISPR1-amer1 chemical treatment by environment: IWR-1-endo Figure 10 with image from Sun et al., 2024
cranial cartilage chondrocyte disorganized, abnormal ba2Tg + CRISPR1-amer1 (TU) control Figure 4 with image from Sun et al., 2024
Meckel's cartilage disorganized, abnormal ba2Tg + CRISPR1-amer1 (TU) control Figure 4 with image from Sun et al., 2024
palatoquadrate cartilage disorganized, abnormal ba2Tg + CRISPR1-amer1 (TU) control Figure 4 with image from Sun et al., 2024
ceratohyal cartilage disorganized, abnormal ba2Tg + CRISPR1-amer1 (TU) control Figure 4 with image from Sun et al., 2024
cranial cartilage chondrocyte swollen, abnormal ba2Tg + CRISPR1-amer1 (TU) control Figure 4 with image from Sun et al., 2024
cranial neural crest cell apoptotic process increased process quality, abnormal ba2Tg + CRISPR1-amer1 (TU) control Figure 6 with image from Sun et al., 2024
cranial neural crest cell Ab47-h3 labeling decreased distribution, abnormal ba2Tg + CRISPR1-amer1 (TU) control Figure 6 with image from Sun et al., 2024
cranial neural crest cell cell population proliferation decreased process quality, abnormal ba2Tg + CRISPR1-amer1 (TU) control Figure 6 with image from Sun et al., 2024
ventral mandibular arch malformed, abnormal amer1zf4147/zf4147 + MO1-upf3a (TU) control Figure 5 with image from Sun et al., 2024
cranial cartilage chondrocyte swollen, abnormal amer1zf4147/zf4147; ba2Tg + MO1-upf3a (TU) control Figure 5 with image from Sun et al., 2024
cranial cartilage chondrocyte disorganized, abnormal amer1zf4147/zf4147; ba2Tg + MO1-upf3a (TU) control Figure 5 with image from Sun et al., 2024
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.