CRISPR

CRISPR1-cd248a

ID
ZDB-CRISPR-171010-3
Name
CRISPR1-cd248a
Previous Names
None
Target
Sequence
5' - GGCTACCATCAGACATCCAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
cc11 cd248a
el679 cd248a
Expression
Gene expression in Wild Types + CRISPR1-cd248a
No data available
Phenotype
Phenotype resulting from CRISPR1-cd248a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-cd248a
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal cd248acc11/cc11 standard conditions Fig. 3 with image from Wang et al., 2025
pericyte cell population proliferation decreased occurrence, abnormal cd248acc11/cc11 chemical treatment by environment: cobalt dichloride Fig. 7 with image from Wang et al., 2025
pericyte casp3a expression increased amount, abnormal cd248acc11/cc11 chemical treatment by environment: cobalt dichloride Fig. 7 with image from Wang et al., 2025
pericyte tp53 expression increased amount, abnormal cd248acc11/cc11 chemical treatment by environment: cobalt dichloride Fig. 7 with image from Wang et al., 2025
pericyte cdkn1a expression increased amount, abnormal cd248acc11/cc11 standard conditions Fig. 6 with image from Wang et al., 2025
pericyte baxa expression increased amount, abnormal cd248acc11/cc11 chemical treatment by environment: cobalt dichloride Fig. 7 with image from Wang et al., 2025
pericyte tp53 expression increased amount, abnormal cd248acc11/cc11 standard conditions Fig. 6 with image from Wang et al., 2025
pericyte cell population proliferation decreased occurrence, abnormal cd248acc11/cc11 standard conditions Fig. 7 with image from Wang et al., 2025
pericyte gadd45aa expression increased amount, abnormal cd248acc11/cc11 standard conditions Fig. 6 with image from Wang et al., 2025
pericyte mdm2 expression increased amount, abnormal cd248acc11/cc11 standard conditions Fig. 6 with image from Wang et al., 2025
trunk pericyte apoptotic, abnormal cd248acc11/cc11 chemical treatment by environment: cobalt dichloride Fig. 7 with image from Wang et al., 2025
pericyte casp9 expression increased amount, abnormal cd248acc11/cc11 chemical treatment by environment: cobalt dichloride Fig. 7 with image from Wang et al., 2025
trunk pericyte apoptotic, ameliorated cd248acc11/cc11 + MO4-tp53 chemical treatment by environment: cobalt dichloride Fig. 7 with image from Wang et al., 2025
pericyte cell population proliferation decreased occurrence, abnormal cd248acc11/cc11 + MO4-tp53 chemical treatment by environment: cobalt dichloride Fig. 7 with image from Wang et al., 2025
brain pericyte decreased amount, abnormal cd248acc11/cc11; pdgfrbion33dTg; c369Tg chemical treatment by environment: 6,7-dimethyl-2-phenylquinoxaline Fig. 6 with image from Wang et al., 2025
pericyte cell population proliferation decreased occurrence, abnormal cd248acc11/cc11; pdgfrbion33dTg; c369Tg standard conditions Fig. 6 with image from Wang et al., 2025
brain pericyte decreased amount, abnormal cd248acc11/cc11; pdgfrbion33dTg; c369Tg; um13Tg standard conditions Fig. 4 with imageFig. 5 with image from Wang et al., 2025
trunk pericyte decreased amount, abnormal cd248acc11/cc11; pdgfrbion33dTg; c369Tg; um13Tg standard conditions Fig. 4 with image from Wang et al., 2025
endothelial blood brain barrier increased permeability, abnormal cd248acc11/cc11; pdgfrbion33dTg; c369Tg; um13Tg standard conditions Fig. 5 with image from Wang et al., 2025
brain pericyte decreased amount, abnormal cd248acc11/cc11; cd248bcc12/cc12; pdgfrbion33dTg; c369Tg; um13Tg standard conditions Fig. 4 with image from Wang et al., 2025
trunk pericyte decreased amount, abnormal cd248acc11/cc11; cd248bcc12/cc12; pdgfrbion33dTg; c369Tg; um13Tg standard conditions Fig. 4 with image from Wang et al., 2025
Citations