CRISPR

CRISPR1-smyd1a

ID
ZDB-CRISPR-180503-3
Name
CRISPR1-smyd1a
Previous Names
None
Target
Sequence
5' - GGACCTGAAGGAGCTCAAAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mb4 smyd1a
mb5 smyd1a
Expression
Gene expression in Wild Types + CRISPR1-smyd1a
No data available
Phenotype
Phenotype resulting from CRISPR1-smyd1a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-smyd1a
Phenotype Fish Conditions Figures
somite smyd1a expression decreased amount, abnormal smyd1amb4/mb4 standard conditions Fig. 7 from Cai et al., 2019
whole organism smyd1a expression decreased amount, abnormal smyd1amb5/mb5 standard conditions Fig. 7 from Cai et al., 2019
somite smyd1a expression decreased amount, abnormal smyd1amb5/mb5 standard conditions Fig. 7 from Cai et al., 2019
head muscle myosin filament disorganized, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 2 from Jiao et al., 2021
myocardium unc45b expression increased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 6 from Jiao et al., 2021
whole organism hsp90aa1.1 expression increased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 14 from Cai et al., 2019
extraocular musculature sarcomere organization decreased process quality, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 4 from Jiao et al., 2021
pericardium edematous, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 5 from Jiao et al., 2021
whole organism dnaja expression increased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 14 from Cai et al., 2019
hyohyoideus ab-a4.1025 labeling absent, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 1 from Jiao et al., 2021
extraocular musculature myosin filament disorganized, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 4 from Jiao et al., 2021
cardiac muscle cell actin filament bundle disorganized, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 6 from Jiao et al., 2021
head muscle actin filament bundle disorganized, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 2 from Jiao et al., 2021
extraocular musculature Z disc disorganized, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 4 from Jiao et al., 2021
slow muscle cell myosin filament disorganized, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 10 from Cai et al., 2019
adaxial cell ab-f59 labeling decreased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 13 from Cai et al., 2019
fast muscle cell Z disc decreased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11 from Cai et al., 2019
head muscle hsp90aa1.1 expression increased distribution, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 3 from Jiao et al., 2021
interhyoideus ab-a4.1025 labeling absent, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 1 from Jiao et al., 2021
atrial myocardium decreased thickness, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 5 from Jiao et al., 2021
head muscle skeletal muscle fiber development disrupted, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 2 from Jiao et al., 2021
fast muscle cell myosin filament decreased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11,  Fig. 12 from Cai et al., 2019
fast muscle cell sarcomere morphology, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11,  Fig. 12 from Cai et al., 2019
head muscle Z disc ab1-actn labeling spatial pattern, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 2 from Jiao et al., 2021
cardiac muscle cell Z disc ab1-actn labeling spatial pattern, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 6 from Jiao et al., 2021
myocardium ab-a4.1025 labeling absent, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 5 from Jiao et al., 2021
head muscle hsp90aa1.1 expression increased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 3 from Jiao et al., 2021
somite dnaja expression increased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 14 from Cai et al., 2019
fast muscle cell Z disc disorganized, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11 from Cai et al., 2019
myocardium hsp90aa1.1 expression increased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 6 from Jiao et al., 2021
head muscle unc45b expression increased distribution, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 3 from Jiao et al., 2021
myocardium unc45b expression increased distribution, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 6 from Jiao et al., 2021
ventricular myocardium decreased thickness, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 5 from Jiao et al., 2021
head muscle unc45b expression increased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 3 from Jiao et al., 2021
ventral intermandibularis anterior ab-a4.1025 labeling absent, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 1 from Jiao et al., 2021
trunk musculature unc45b expression increased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 6 from Jiao et al., 2021
fast muscle cell sarcomere disorganized, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11,  Fig. 12 from Cai et al., 2019
head muscle sarcomere organization decreased process quality, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 2 from Jiao et al., 2021
extraocular musculature actin filament bundle disorganized, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 4 from Jiao et al., 2021
cardiac muscle sarcomere organization decreased process quality, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 6 from Jiao et al., 2021
ventral intermandibularis posterior ab-a4.1025 labeling absent, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 1 from Jiao et al., 2021
heart contraction absent process, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 5 from Jiao et al., 2021
slow muscle cell myosin filament decreased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 10 from Cai et al., 2019
myocardium hsp90aa1.1 expression increased distribution, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 6 from Jiao et al., 2021
extraocular musculature myosin filament ab-f310 labeling spatial pattern, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 4 from Jiao et al., 2021
head muscle Z disc disorganized, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 2 from Jiao et al., 2021
head muscle ab-a4.1025 labeling absent, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 1 from Jiao et al., 2021
fast muscle cell myosin filament ab-mf20 labeling decreased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11 from Cai et al., 2019
head muscle myosin filament ab-f310 labeling spatial pattern, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 2 from Jiao et al., 2021
slow muscle cell sarcomere morphology, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 10 from Cai et al., 2019
somite hsp90aa1.1 expression increased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 14 from Cai et al., 2019
trunk musculature unc45b expression increased distribution, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 6 from Jiao et al., 2021
adductor mandibulae ab-a4.1025 labeling absent, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 1 from Jiao et al., 2021
cardiac muscle cell Z disc disorganized, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 6 from Jiao et al., 2021
fast muscle cell M band ab1-myom labeling decreased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11 from Cai et al., 2019
extraocular musculature Z disc ab1-actn labeling spatial pattern, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 4 from Jiao et al., 2021
fast muscle cell myosin filament disorganized, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11 from Cai et al., 2019
head muscle muscle cell disorganized, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 2 from Jiao et al., 2021
sternohyoid ab-a4.1025 labeling absent, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 1 from Jiao et al., 2021
fast muscle cell M band disorganized, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11 from Cai et al., 2019
extraocular musculature ab-a4.1025 labeling absent, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 4 from Jiao et al., 2021
fast muscle cell morphology, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11 from Cai et al., 2019
fast muscle cell M band decreased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5 standard conditions Fig. 11,  Fig. 12 from Cai et al., 2019
slow muscle cell morphology, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5; myom3mn0067Gt standard conditions Fig. 10 from Cai et al., 2019
slow muscle cell M band decreased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5; myom3mn0067Gt standard conditions Fig. 10 from Cai et al., 2019
slow muscle cell sarcomere morphology, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5; myom3mn0067Gt standard conditions Fig. 10 from Cai et al., 2019
slow muscle cell M band mRFP1 expression decreased amount, abnormal smyd1bsa15678/sa15678; smyd1amb5/mb5; myom3mn0067Gt standard conditions Fig. 10 from Cai et al., 2019
Citations