CRISPR

CRISPR1-cdh1

ID
ZDB-CRISPR-190419-1
Name
CRISPR1-cdh1
Previous Names
None
Target
Sequence
5' - GGACATGTATGGAGGAGGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
xt17Tg cdh1
xt18Tg cdh1
Expression
Gene expression in Wild Types + CRISPR1-cdh1
No data available
Phenotype
Phenotype resulting from CRISPR1-cdh1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-cdh1
Phenotype Fish Conditions Figures
caudal fin epidermal basal stratum Tomato expression spatial pattern, abnormal col1a1aya392/+; cdh1xt18Tg/xt18Tg standard conditions Fig. 5 with image from He et al., 2025
caudal fin epidermal superficial stratum Ab1-dsp labeling spatial pattern, abnormal col1a1aya392/+; cdh1xt18Tg/xt18Tg standard conditions Fig. 5 with image from He et al., 2025
caudal fin epidermal superficial stratum Tomato expression spatial pattern, abnormal col1a1aya392/+; cdh1xt18Tg/xt18Tg standard conditions Fig. 5 with image from He et al., 2025
caudal fin epidermal basal stratum Ab1-dsp labeling spatial pattern, abnormal col1a1aya392/+; cdh1xt18Tg/xt18Tg standard conditions Fig. 5 with image from He et al., 2025
caudal fin epidermal superficial stratum Ab1-dsp labeling spatial pattern, abnormal lama5ya377/+; cdh1xt18Tg/xt18Tg standard conditions Fig. 5 with image from He et al., 2025
caudal fin epidermal basal stratum Tomato expression spatial pattern, abnormal lama5ya377/+; cdh1xt18Tg/xt18Tg standard conditions Fig. 5 with image from He et al., 2025
caudal fin epidermal basal stratum Ab1-dsp labeling spatial pattern, abnormal lama5ya377/+; cdh1xt18Tg/xt18Tg standard conditions Fig. 5 with image from He et al., 2025
epidermal basal stratum central region Tomato expression spatial pattern, abnormal itgb1ask109/+; itgb1bsk110/+; cdh1xt18Tg/xt18Tg standard conditions Fig. 3 with image from He et al., 2025
epidermal basal stratum peripheral region Tomato expression spatial pattern, abnormal itgb1ask109/+; itgb1bsk110/+; cdh1xt18Tg/xt18Tg standard conditions Fig. 3 with image from He et al., 2025
epidermal superficial stratum central region Ab1-dsp labeling spatial pattern, abnormal itgb1ask109/+; itgb1bsk110/+; cdh1xt18Tg/xt18Tg standard conditions Fig. 3 with image from He et al., 2025
epidermal superficial stratum central region Tomato expression spatial pattern, abnormal itgb1ask109/+; itgb1bsk110/+; cdh1xt18Tg/xt18Tg standard conditions Fig. 3 with image from He et al., 2025
epidermal superficial stratum peripheral region Ab1-dsp labeling spatial pattern, abnormal itgb1ask109/+; itgb1bsk110/+; cdh1xt18Tg/xt18Tg standard conditions Fig. 3 with image from He et al., 2025
epidermal basal stratum peripheral region Ab1-dsp labeling spatial pattern, abnormal itgb1ask109/+; itgb1bsk110/+; cdh1xt18Tg/xt18Tg standard conditions Fig. 3 with image from He et al., 2025
epidermal superficial stratum peripheral region Tomato expression spatial pattern, abnormal itgb1ask109/+; itgb1bsk110/+; cdh1xt18Tg/xt18Tg standard conditions Fig. 3 with image from He et al., 2025
epidermal basal stratum central region Ab1-dsp labeling spatial pattern, abnormal itgb1ask109/+; itgb1bsk110/+; cdh1xt18Tg/xt18Tg standard conditions Fig. 3 with image from He et al., 2025
Citations