CRISPR

CRISPR1-shoc2

ID
ZDB-CRISPR-190604-2
Name
CRISPR1-shoc2
Previous Names
None
Target
Sequence
5' - GGTGGGATGCCTGTCAGGAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
uky101 shoc2
Expression
Gene expression in Wild Types + CRISPR1-shoc2
No data available
Phenotype
Phenotype resulting from CRISPR1-shoc2
No data available
Phenotype of all Fish created by or utilizing CRISPR1-shoc2
Phenotype Fish Conditions Figures
whole organism gata2a expression decreased amount, abnormal shoc2uky101/uky101 standard conditions Fig. 7 from Jang et al., 2018
ceratohyal cartilage angle ceratohyal cartilage, abnormal shoc2uky101/uky101 standard conditions Fig. 4 from Jang et al., 2018
whole organism foxd3 expression increased amount, abnormal shoc2uky101/uky101 standard conditions Fig. 5 from Jang et al., 2018
eye decreased area, abnormal shoc2uky101/uky101 standard conditions Fig. 4 from Jang et al., 2018
pupil increased distance pupil, abnormal shoc2uky101/uky101 standard conditions Fig. 4 from Jang et al., 2018
vertebral column decreased width, abnormal shoc2uky101/uky101 standard conditions Fig. 4 from Jang et al., 2018
whole organism lcp1 expression decreased amount, abnormal shoc2uky101/uky101 standard conditions Fig. 7 from Jang et al., 2018
branchiostegal ray 1 ossification decreased occurrence, abnormal shoc2uky101/uky101 standard conditions Fig. 5 from Jang et al., 2018
branchiostegal ray 2 ossification decreased occurrence, abnormal shoc2uky101/uky101 standard conditions Fig. 5 from Jang et al., 2018
ceratohyal cartilage length, abnormal shoc2uky101/uky101 standard conditions Fig. 4 from Jang et al., 2018
whole organism spi1b expression decreased amount, abnormal shoc2uky101/uky101 standard conditions Fig. 7 from Jang et al., 2018
caudal hematopoietic tissue has fewer parts of type neutrophil, abnormal shoc2uky101/uky101 standard conditions Fig. 6 from Jang et al., 2018
whole organism lck expression decreased amount, abnormal shoc2uky101/uky101 standard conditions Fig. 7 from Jang et al., 2018
blood has fewer parts of type cell, abnormal shoc2uky101/uky101 standard conditions Fig. 7 from Jang et al., 2018
bone development disrupted, abnormal shoc2uky101/uky101 standard conditions Fig. 5 from Jang et al., 2018
yolk decreased size, abnormal shoc2uky101/uky101 standard conditions Fig. 3 from Jang et al., 2018
eye edematous, abnormal shoc2uky101/uky101 standard conditions Fig. 3 from Jang et al., 2018
nucleate erythrocyte spherical, abnormal shoc2uky101/uky101 standard conditions Fig. 7 from Jang et al., 2018
nucleate erythrocyte decreased volume, abnormal shoc2uky101/uky101 standard conditions Fig. 7 from Jang et al., 2018
whole organism mpx expression decreased amount, abnormal shoc2uky101/uky101 standard conditions Fig. 7 from Jang et al., 2018
nucleate erythrocyte nucleus decreased size, abnormal shoc2uky101/uky101 standard conditions Fig. 7 from Jang et al., 2018
whole organism rag1 expression decreased amount, abnormal shoc2uky101/uky101 standard conditions Fig. 7 from Jang et al., 2018
whole organism gata1a expression decreased amount, abnormal shoc2uky101/uky101 standard conditions Fig. 7 from Jang et al., 2018
parasphenoid ossification decreased occurrence, abnormal shoc2uky101/uky101 standard conditions Fig. 5 from Jang et al., 2018
heart contraction increased rate, abnormal shoc2uky101/uky101 standard conditions text only from Jang et al., 2018
splanchnocranium ossification disrupted, abnormal shoc2uky101/uky101 standard conditions Fig. 5 from Jang et al., 2018
nucleate erythrocyte shape, abnormal shoc2uky101/uky101 standard conditions Fig. 7 from Jang et al., 2018
pharyngeal arch 2 skeleton decreased length, abnormal shoc2uky101/uky101 standard conditions Fig. 4 from Jang et al., 2018
blood has fewer parts of type nucleate erythrocyte, abnormal shoc2uky101/uky101 standard conditions Fig. 6,  Fig. 7 from Jang et al., 2018
peritoneum edematous, abnormal shoc2uky101/uky101 standard conditions Fig. 3 from Jang et al., 2018
eye edematous, abnormal shoc2uky102/+; shoc2uky101/+ standard conditions Fig. S5 from Jang et al., 2018
peritoneum edematous, abnormal shoc2uky102/+; shoc2uky101/+ standard conditions Fig. S5 from Jang et al., 2018
Citations