CRISPR

CRISPR1-nup62l

ID

ZDB-CRISPR-200305-1

Name

CRISPR1-nup62l

Previous Names

None

Target

nup62l (1)

Sequence

5' - GGGGCTTCAACCACTGGGAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3224	nup62l

Expression

Gene expression in Wild Types + CRISPR1-nup62l

No data available

Phenotype

Phenotype resulting from CRISPR1-nup62l

No data available

Phenotype of all Fish created by or utilizing CRISPR1-nup62l

Phenotype	Fish	Conditions	Figures
pharyngeal arch 3-7 sox9a expression decreased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 3 from Yang et al., 2019
optic tectum casp8 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
pharyngeal arch fsta expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
whole organism mdm2 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	control	Figure 7 from Yang et al., 2019
Meckel's cartilage absent, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 1 from Yang et al., 2019
optic tectum fsta expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
eye bbc3 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
optic tectum bbc3 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
eye apoptotic process process quality, ameliorated	nup62l^{zf3224/zf3224} (AB)	chemical treatment: Wnt signalling activator	Figure 7 from Yang et al., 2019
ceratobranchial 3 cartilage chondrocyte disorganized, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 2 , Figure 6 from Yang et al., 2019
eye casp9 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
pharyngeal arch bbc3 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
hyosymplectic cartilage absent, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 1 from Yang et al., 2019
whole organism tp53bp1 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 6 , Figure 7 from Yang et al., 2019
whole organism tp53i11a expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 6 , Figure 7 from Yang et al., 2019
pharyngeal arch tp53 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
pharyngeal arch 2 sox9a expression decreased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 3 from Yang et al., 2019
whole organism fsta expression amount, ameliorated	nup62l^{zf3224/zf3224} (AB)	chemical treatment: Wnt signalling activator	Figure 7 from Yang et al., 2019
pharyngeal arch apoptotic process process quality, ameliorated	nup62l^{zf3224/zf3224} (AB)	chemical treatment: Wnt signalling activator	Figure 7 from Yang et al., 2019
optic tectum casp9 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
ceratobranchial 4 cartilage chondrocyte disorganized, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 2 , Figure 6 from Yang et al., 2019
eye apoptotic process increased process quality, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 4 , Figure 5 , Figure 6 , Figure 7 from Yang et al., 2019
eye tp53 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
whole organism casp8 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	control	Figure 7 from Yang et al., 2019
pharyngeal arch 1 sox9a expression decreased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 3 from Yang et al., 2019
whole organism casp9 expression amount, ameliorated	nup62l^{zf3224/zf3224} (AB)	chemical treatment: Wnt signalling activator	Figure 7 from Yang et al., 2019
pharyngeal arch 1 ventral region sox9a expression decreased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 3 from Yang et al., 2019
pharyngeal arch mdm2 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
ceratobranchial 2 cartilage chondrocyte disorganized, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 2 , Figure 6 from Yang et al., 2019
optic tectum casp3b expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 4 from Yang et al., 2019
whole organism tp53i11a expression amount, ameliorated	nup62l^{zf3224/zf3224} (AB)	chemical treatment: Wnt signalling activator	Figure 7 from Yang et al., 2019
pharyngeal arch casp9 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
pharyngeal arch 2 ventral region sox9a expression decreased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 3 from Yang et al., 2019
whole organism tp53i11b expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 6 , Figure 7 from Yang et al., 2019
whole organism fadd expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	control	Figure 7 from Yang et al., 2019
whole organism tp53 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	control	Figure 7 from Yang et al., 2019
pharyngeal arch casp3b expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 4 from Yang et al., 2019
ceratohyal bone absent, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 1 from Yang et al., 2019
optic tectum tp53 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
palatoquadrate cartilage absent, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 1 from Yang et al., 2019
pharyngeal arch sox9a expression absent, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 3 from Yang et al., 2019
eye casp8 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
ceratobranchial cartilage absent, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 1 from Yang et al., 2019
whole organism mdm2 expression amount, ameliorated	nup62l^{zf3224/zf3224} (AB)	chemical treatment: Wnt signalling activator	Figure 7 from Yang et al., 2019
pharyngeal arch apoptotic process increased process quality, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 4 , Figure 5 , Figure 6 , Figure 7 from Yang et al., 2019
pharyngeal arch col2a1a expression decreased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 3 from Yang et al., 2019
pharyngeal arch gadd45aa expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
eye casp3a expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 4 from Yang et al., 2019
pharyngeal arch morphology, ameliorated	nup62l^{zf3224/zf3224} (AB)	chemical treatment: Wnt signalling activator	Figure 7 from Yang et al., 2019
eye mdm2 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
pharyngeal arch absent, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 1 , Figure 7 from Yang et al., 2019
optic tectum apoptotic process process quality, ameliorated	nup62l^{zf3224/zf3224} (AB)	chemical treatment: Wnt signalling activator	Figure 7 from Yang et al., 2019
pharyngeal arch casp8 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
optic tectum apoptotic process increased process quality, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 4 , Figure 5 , Figure 6 , Figure 7 from Yang et al., 2019
optic tectum casp3a expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 4 from Yang et al., 2019
whole organism gadd45aa expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	control	Figure 7 from Yang et al., 2019
whole organism casp9 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	control	Figure 7 from Yang et al., 2019
whole organism gadd45aa expression amount, ameliorated	nup62l^{zf3224/zf3224} (AB)	chemical treatment: Wnt signalling activator	Figure 7 from Yang et al., 2019
pharyngeal arch col2a1a expression absent, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 3 from Yang et al., 2019
eye gadd45aa expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
whole organism fsta expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	control	Figure 7 from Yang et al., 2019
hypobranchial cartilage absent, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 1 from Yang et al., 2019
pharyngeal arch decreased thickness, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 1 , Figure 6 from Yang et al., 2019
whole organism bbc3 expression amount, ameliorated	nup62l^{zf3224/zf3224} (AB)	chemical treatment: Wnt signalling activator	Figure 7 from Yang et al., 2019
whole organism bbc3 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	control	Figure 7 from Yang et al., 2019
whole organism tp53bp1 expression amount, ameliorated	nup62l^{zf3224/zf3224} (AB)	chemical treatment: Wnt signalling activator	Figure 7 from Yang et al., 2019
eye fsta expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
optic tectum gadd45aa expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
whole organism tp53 expression amount, ameliorated	nup62l^{zf3224/zf3224} (AB)	chemical treatment: Wnt signalling activator	Figure 7 from Yang et al., 2019
optic tectum mdm2 expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 5 from Yang et al., 2019
whole organism fadd expression amount, ameliorated	nup62l^{zf3224/zf3224} (AB)	chemical treatment: Wnt signalling activator	Figure 7 from Yang et al., 2019
eye casp3b expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 4 from Yang et al., 2019
pharyngeal arch shortened, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 1 , Figure 6 from Yang et al., 2019
whole organism casp8 expression amount, ameliorated	nup62l^{zf3224/zf3224} (AB)	chemical treatment: Wnt signalling activator	Figure 7 from Yang et al., 2019
whole organism tp53i11b expression amount, ameliorated	nup62l^{zf3224/zf3224} (AB)	chemical treatment: Wnt signalling activator	Figure 7 from Yang et al., 2019
pharyngeal arch casp3a expression increased amount, abnormal	nup62l^{zf3224/zf3224} (AB)	standard conditions	Figure 4 from Yang et al., 2019
whole organism tp53i11b expression amount, ameliorated	nup62l^{zf3224/zf3224} + MO4-tp53 (AB)	control	Figure 6 from Yang et al., 2019
ceratobranchial 2 cartilage chondrocyte organization quality, ameliorated	nup62l^{zf3224/zf3224} + MO4-tp53 (AB)	control	Figure 6 from Yang et al., 2019
whole organism tp53i11a expression amount, ameliorated	nup62l^{zf3224/zf3224} + MO4-tp53 (AB)	control	Figure 6 from Yang et al., 2019
ceratobranchial 4 cartilage chondrocyte organization quality, ameliorated	nup62l^{zf3224/zf3224} + MO4-tp53 (AB)	control	Figure 6 from Yang et al., 2019
eye apoptotic process process quality, ameliorated	nup62l^{zf3224/zf3224} + MO4-tp53 (AB)	control	Figure 6 from Yang et al., 2019
whole organism tp53bp1 expression amount, ameliorated	nup62l^{zf3224/zf3224} + MO4-tp53 (AB)	control	Figure 6 from Yang et al., 2019
pharyngeal arch apoptotic process process quality, ameliorated	nup62l^{zf3224/zf3224} + MO4-tp53 (AB)	control	Figure 6 from Yang et al., 2019
pharyngeal arch thickness, ameliorated	nup62l^{zf3224/zf3224} + MO4-tp53 (AB)	control	Figure 6 from Yang et al., 2019
pharyngeal arch length, ameliorated	nup62l^{zf3224/zf3224} + MO4-tp53 (AB)	control	Figure 6 from Yang et al., 2019
optic tectum apoptotic process process quality, ameliorated	nup62l^{zf3224/zf3224} + MO4-tp53 (AB)	control	Figure 6 from Yang et al., 2019
ceratobranchial 3 cartilage chondrocyte organization quality, ameliorated	nup62l^{zf3224/zf3224} + MO4-tp53 (AB)	control	Figure 6 from Yang et al., 2019

Citations