CRISPR

CRISPR1-capn3b

ID
ZDB-CRISPR-200720-6
Name
CRISPR1-capn3b
Previous Names
None
Target
Sequence
5' - GAATGATGTCATCCTGAAGAGGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zju20 capn3b
Expression
Gene expression in Wild Types + CRISPR1-capn3b
No data available
Phenotype
Phenotype resulting from CRISPR1-capn3b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-capn3b
Phenotype Fish Conditions Figures
whole organism capn3b expression absent, abnormal capn3bzju20/zju20 standard conditions Fig. S8 from Zhao et al., 2019
whole organism mphosph10 expression increased amount, abnormal capn3bzju20/zju20 standard conditions Fig. S8 from Zhao et al., 2019
liver fabp10a expression absent, abnormal capn3bzju20/zju20 (AB) heat exposure Fig. 2 with image from Chen et al., 2020
muscle capn3b expression absent, abnormal capn3bzju20/zju20 (AB) standard conditions Fig. 1 with image from Chen et al., 2020
whole organism capn3b expression absent, abnormal capn3bzju20/zju20 (AB) standard conditions Fig. 1 with image from Chen et al., 2020
liver regenerating tissue tp53 expression increased amount, abnormal capn3bzju20/zju20 (AB) amputation: liver Fig. 9 with image from Chen et al., 2020
growth delayed, abnormal capn3bzju20/zju20 (AB) standard conditions Fig. 2 with image from Chen et al., 2020
exocrine pancreas prss1 expression absent, abnormal capn3bzju20/zju20 (AB) heat exposure Fig. 2 with image from Chen et al., 2020
liver Ab5-chek1 labeling increased amount, abnormal capn3bzju20/zju20 (AB) amputation: liver Fig. 9 with image from Chen et al., 2020
regenerating tissue cell population proliferation delayed, abnormal capn3bzju20/zju20 (AB) amputation: liver Fig. 3 with image,  Fig. 4 with image from Chen et al., 2020
liver nucleolus Ab1-wee1 labeling increased amount, abnormal capn3bzju20/zju20 (AB) amputation: liver Fig. 9 with image from Chen et al., 2020
exocrine pancreas development delayed, abnormal capn3bzju20/zju20 (AB) heat exposure Fig. 2 with image from Chen et al., 2020
whole organism curved, abnormal capn3bzju20/zju20 (AB) heat exposure Fig. 2 with image from Chen et al., 2020
whole organism capn3b expression absent, abnormal capn3bzju20/zju20 (AB) heat exposure Fig. 9 with image from Chen et al., 2020
embryonic liver development delayed, abnormal capn3bzju20/zju20 (AB) heat exposure Fig. 2 with image from Chen et al., 2020
whole organism Ab5-chek1 labeling increased amount, abnormal capn3bzju20/zju20 (AB) heat exposure Fig. 9 with image from Chen et al., 2020
liver increased size, abnormal capn3bzju20/zju20 (AB) overcrowding Fig. 2 with image from Chen et al., 2020
liver nucleus Ab1-wee1 labeling decreased amount, abnormal capn3bzju20/zju20 (AB) amputation: liver Fig. 9 with image from Chen et al., 2020
liver decreased size, abnormal capn3bzju20/zju20 (AB) undercrowding Fig. 2 with image from Chen et al., 2020
liver regeneration delayed, abnormal capn3bzju20/zju20 (AB) amputation: liver Fig. 3 with image,  Fig. 4 with image from Chen et al., 2020
whole organism decreased size, abnormal capn3bzju20/zju20 (AB) standard conditions Fig. 2 with image from Chen et al., 2020
Citations