CRISPR

CRISPR1-cyp17a2

ID

ZDB-CRISPR-221230-9

Name

CRISPR1-cyp17a2

Previous Names

None

Target

cyp17a2 (1)

Sequence

5' - GGGGCAGAGAGTTCGCCGGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3680	cyp17a2

Expression

Gene expression in Wild Types + CRISPR1-cyp17a2

No data available

Phenotype

Phenotype resulting from CRISPR1-cyp17a2

No data available

Phenotype of all Fish created by or utilizing CRISPR1-cyp17a2

Phenotype	Fish	Conditions	Figures
female organism 17,20-dihydroxypregn-4-en-3-one increased amount, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 3 from Shi et al., 2022
male organism 17,20-dihydroxypregn-4-en-3-one increased amount, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 3 from Shi et al., 2022
male organism estradiol increased amount, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 3 from Shi et al., 2022
female organism decreased female fertility, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 5 from Shi et al., 2022
female organism cortisol decreased amount, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 3 from Shi et al., 2022
female organism hypophysis pomca expression increased amount, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 7 from Shi et al., 2022
interrenal gland decreased size, ameliorated	cyp17a2^{zf3680/zf3680} (AB)	chemical treatment by environment: cortisol	Figure 2 from Shi et al., 2022
female organism ovulation absent process, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 5 from Shi et al., 2022
male organism hypophysis pomca expression increased amount, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 7 from Shi et al., 2022
hypophysis pomca expression increased amount, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 2 from Shi et al., 2022
interrenal gland hsd3b1 expression increased amount, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 2 from Shi et al., 2022
interrenal gland increased size, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 2 from Shi et al., 2022
interrenal gland cyp21a2 expression increased amount, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 2 from Shi et al., 2022
male organism 11-oxotestosterone increased amount, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 3 from Shi et al., 2022
oocyte maturation premature, abnormal	cyp17a2^{zf3680/zf3680} (AB)	chemical treatment by environment: cortisol	Figure 6 from Shi et al., 2022
female organism testosterone increased amount, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 3 from Shi et al., 2022
aerobic respiration decreased occurrence, abnormal	cyp17a2^{zf3680/zf3680} (AB)	limited food availability	Figure 4 from Shi et al., 2022
male organism decreased male fertility, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 5 from Shi et al., 2022
male organism progesterone increased amount, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 3 from Shi et al., 2022
female organism progesterone increased amount, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 3 from Shi et al., 2022
urogenital papilla decreased size, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 5 from Shi et al., 2022
swimming decreased linear velocity, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 4 from Shi et al., 2022
interrenal gland cyp21a2 expression amount, ameliorated	cyp17a2^{zf3680/zf3680} (AB)	chemical treatment by environment: cortisol	Figure 2 from Shi et al., 2022
swimming decreased linear velocity, abnormal	cyp17a2^{zf3680/zf3680} (AB)	stress	Figure 4 from Shi et al., 2022
oocyte maturation premature, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 6 from Shi et al., 2022
interrenal gland cyp11a1.1 expression increased amount, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 2 from Shi et al., 2022
male organism cortisol decreased amount, abnormal	cyp17a2^{zf3680/zf3680} (AB)	standard conditions	Figure 3 from Shi et al., 2022
interrenal gland hsd3b1 expression amount, ameliorated	cyp17a2^{zf3680/zf3680}; pomca^{ihb408/ihb408} (AB)	standard conditions	Figure 2 from Shi et al., 2022
interrenal gland normal size, ameliorated	cyp17a2^{zf3680/zf3680}; pomca^{ihb408/ihb408} (AB)	standard conditions	Figure 2 from Shi et al., 2022
interrenal gland cyp21a2 expression amount, ameliorated	cyp17a2^{zf3680/zf3680}; pomca^{ihb408/ihb408} (AB)	standard conditions	Figure 2 from Shi et al., 2022
interrenal gland cyp11a1.1 expression amount, ameliorated	cyp17a2^{zf3680/zf3680}; pomca^{ihb408/ihb408} (AB)	standard conditions	Figure 2 from Shi et al., 2022
hypophysis pomca expression amount, ameliorated	cyp17a2^{zf3680/zf3680}; pomca^{ihb408/ihb408} (AB)	standard conditions	Figure 2 from Shi et al., 2022

Citations