CRISPR

CRISPR11-chd7

ID
ZDB-CRISPR-230612-1
Name
CRISPR11-chd7
Previous Names
None
Target
Sequence
5' - CTTCAACCCAGATTATGTGGAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ncu101 chd7
Expression
Gene expression in Wild Types + CRISPR11-chd7
No data available
Phenotype
Phenotype resulting from CRISPR11-chd7
No data available
Phenotype of all Fish created by or utilizing CRISPR11-chd7
Phenotype Fish Conditions Figures
embryonic cranial skeleton morphogenesis disrupted, abnormal chd7ncu101/ncu101 (TL) standard conditions Fig. 1 with image from Hodorovich et al., 2023
otolith morphology, abnormal chd7ncu101/ncu101 (TL) acoustic radiation Fig. 3 with image from Hodorovich et al., 2023
cranium morphology, abnormal chd7ncu101/ncu101 (TL) standard conditions Fig. 1 with image from Hodorovich et al., 2023
lapillus decreased amount, abnormal chd7ncu101/ncu101 (TL) standard conditions Fig. 1 with image from Hodorovich et al., 2023
pericardium increased size, abnormal chd7ncu101/ncu101 (TL) standard conditions Fig. 1 with image from Hodorovich et al., 2023
startle response process quality, abnormal chd7ncu101/ncu101 (TL) acoustic radiation Fig. 2 with imageFig. 3 with image from Hodorovich et al., 2023
swim bladder uninflated, abnormal chd7ncu101/ncu101 (TL) standard conditions Fig. 1 with image from Hodorovich et al., 2023
visual behavior process quality, abnormal chd7ncu101/ncu101 (TL) altered light dark cycle Fig. 4 with image from Hodorovich et al., 2023
visual learning process quality, abnormal chd7ncu101/ncu101 (TL) altered light dark cycle Fig. 4 with image from Hodorovich et al., 2023
whole organism decreased life span, abnormal chd7ncu101/ncu101 (TL) standard conditions Fig. 1 with image from Hodorovich et al., 2023
otolith morphology, abnormal chd7ncu101/ncu101 (TL) standard conditions Fig. 1 with image from Hodorovich et al., 2023
sagitta decreased amount, abnormal chd7ncu101/ncu101 (TL) standard conditions Fig. 1 with image from Hodorovich et al., 2023
nonassociative learning disrupted, abnormal chd7ncu101/ncu101 (TL) acoustic radiation Fig. 2 with image from Hodorovich et al., 2023
lapillus decreased size, abnormal chd7ncu101/ncu101 (TL) standard conditions Fig. 1 with image from Hodorovich et al., 2023
cranium morphology, abnormal chd7ncu101/+ (TL) standard conditions Fig. 1 with image from Hodorovich et al., 2023
embryonic cranial skeleton morphogenesis disrupted, abnormal chd7ncu101/+ (TL) standard conditions Fig. 1 with image from Hodorovich et al., 2023
lapillus decreased amount, abnormal chd7ncu101/+ (TL) standard conditions Fig. 1 with image from Hodorovich et al., 2023
pericardium increased size, abnormal chd7ncu101/+ (TL) standard conditions Fig. 1 with image from Hodorovich et al., 2023
swim bladder uninflated, abnormal chd7ncu101/+ (TL) standard conditions Fig. 1 with image from Hodorovich et al., 2023
whole organism decreased life span, abnormal chd7ncu101/+ (TL) standard conditions Fig. 1 with image from Hodorovich et al., 2023
otolith morphology, abnormal chd7ncu101/+ (TL) standard conditions Fig. 1 with image from Hodorovich et al., 2023
sagitta decreased amount, abnormal chd7ncu101/+ (TL) standard conditions Fig. 1 with image from Hodorovich et al., 2023
lapillus decreased size, abnormal chd7ncu101/+ (TL) standard conditions Fig. 1 with image from Hodorovich et al., 2023
Citations