CRISPR

CRISPR1-hdac10

ID
ZDB-CRISPR-230613-1
Name
CRISPR1-hdac10
Previous Names
None
Target
Sequence
5' - GGGAGCAACTCTGCAGCTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
sh401 hdac10
Expression
Gene expression in Wild Types + CRISPR1-hdac10
No data available
Phenotype
Phenotype resulting from CRISPR1-hdac10
No data available
Phenotype of all Fish created by or utilizing CRISPR1-hdac10
Phenotype Fish Conditions Figures
lateral crista kinocilium Ab15-tuba labeling decreased amount, abnormal hdac10sh401/sh401; hdac6sh400/sh400 standard conditions FIGURE 3 with image from ?ysyganicz et al., 2021
posterior crista kinocilium Ab15-tuba labeling decreased distribution, abnormal hdac10sh401/sh401; hdac6sh400/sh400 standard conditions FIGURE 3 with image from ?ysyganicz et al., 2021
posterior crista kinocilium Ab15-tuba labeling decreased amount, abnormal hdac10sh401/sh401; hdac6sh400/sh400 standard conditions FIGURE 3 with image from ?ysyganicz et al., 2021
macula kinocilium Ab15-tuba labeling decreased amount, abnormal hdac10sh401/sh401; hdac6sh400/sh400 standard conditions FIGURE 3 with image from ?ysyganicz et al., 2021
anterior crista kinocilium Ab15-tuba labeling decreased amount, abnormal hdac10sh401/sh401; hdac6sh400/sh400 standard conditions FIGURE 3 with image from ?ysyganicz et al., 2021
macula kinocilium Ab15-tuba labeling decreased distribution, abnormal hdac10sh401/sh401; hdac6sh400/sh400 standard conditions FIGURE 3 with image from ?ysyganicz et al., 2021
lateral crista kinocilium Ab15-tuba labeling decreased distribution, abnormal hdac10sh401/sh401; hdac6sh400/sh400 standard conditions FIGURE 3 with image from ?ysyganicz et al., 2021
anterior crista kinocilium Ab15-tuba labeling decreased distribution, abnormal hdac10sh401/sh401; hdac6sh400/sh400 standard conditions FIGURE 3 with image from ?ysyganicz et al., 2021
inner ear cytoplasmic microtubule Ab15-tuba labeling increased amount, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 3 with image from ?ysyganicz et al., 2021
lateral crista kinocilium ab2-tub-glyc labeling increased amount, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 5 with image from ?ysyganicz et al., 2021
retina photoreceptor connecting cilium ab2-tub-glyc labeling decreased amount, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 3 with image from ?ysyganicz et al., 2021
posterior crista kinocilium ab2-tub-glyc labeling increased distribution, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 5 with image from ?ysyganicz et al., 2021
lateral crista kinocilium Ab15-tuba labeling decreased amount, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 3 with imageFIGURE 5 with image from ?ysyganicz et al., 2021
posterior crista kinocilium ab2-tub-glyc labeling increased amount, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 5 with image from ?ysyganicz et al., 2021
whole organism hdac6 expression increased amount, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 1 with image from ?ysyganicz et al., 2021
anterior crista kinocilium Ab15-tuba labeling decreased amount, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 3 with imageFIGURE 5 with image from ?ysyganicz et al., 2021
whole organism sirt2 expression decreased amount, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 1 with image from ?ysyganicz et al., 2021
lateral crista kinocilium ab2-tub-glyc labeling increased distribution, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 5 with image from ?ysyganicz et al., 2021
posterior crista kinocilium Ab15-tuba labeling decreased distribution, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 3 with imageFIGURE 5 with image from ?ysyganicz et al., 2021
eye ab1-tuba labeling increased amount, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 2 with image from ?ysyganicz et al., 2021
macula kinocilium Ab15-tuba labeling decreased amount, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 3 with image from ?ysyganicz et al., 2021
anterior crista kinocilium ab2-tub-glyc labeling increased distribution, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 5 with image from ?ysyganicz et al., 2021
whole organism swimming behavior decreased process quality, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 mechanical stress FIGURE 7 with image from ?ysyganicz et al., 2021
retina cilium ab2-tub-glyc labeling increased distribution, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 3 with image from ?ysyganicz et al., 2021
retina cell body Ab15-tuba labeling increased amount, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 3 with image from ?ysyganicz et al., 2021
retina photoreceptor connecting cilium Ab15-tuba labeling decreased distribution, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 3 with image from ?ysyganicz et al., 2021
posterior crista kinocilium Ab15-tuba labeling decreased amount, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 3 with imageFIGURE 5 with image from ?ysyganicz et al., 2021
retina cell body Ab15-tuba labeling increased distribution, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 3 with image from ?ysyganicz et al., 2021
retina cilium ab2-tub-glyc labeling increased amount, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 3 with image from ?ysyganicz et al., 2021
anterior crista kinocilium ab2-tub-glyc labeling increased amount, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 5 with image from ?ysyganicz et al., 2021
macula kinocilium Ab15-tuba labeling decreased distribution, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 3 with image from ?ysyganicz et al., 2021
lateral crista kinocilium Ab15-tuba labeling decreased distribution, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 3 with imageFIGURE 5 with image from ?ysyganicz et al., 2021
retina photoreceptor connecting cilium Ab15-tuba labeling decreased amount, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 3 with image from ?ysyganicz et al., 2021
retina photoreceptor connecting cilium ab2-tub-glyc labeling decreased distribution, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 3 with image from ?ysyganicz et al., 2021
whole organism hdac10 expression decreased amount, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 1 with image from ?ysyganicz et al., 2021
inner ear cytoplasmic microtubule Ab15-tuba labeling increased distribution, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 3 with image from ?ysyganicz et al., 2021
anterior crista kinocilium Ab15-tuba labeling decreased distribution, abnormal hdac10sh401/sh401; hdac6sh400/sh400; sirt2sh626/sh626 standard conditions FIGURE 3 with imageFIGURE 5 with image from ?ysyganicz et al., 2021
Citations