CRISPR

CRISPR2-vsx1

ID
ZDB-CRISPR-240605-1
Name
CRISPR2-vsx1
Previous Names
None
Target
Sequence
5' - GGGTTCCTCAAGTTGATGGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first two "G"s were added.
Genome Resources
None
Target Location
View all 3 target locations
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
upo371 vsx1
Expression
Gene expression in Wild Types + CRISPR2-vsx1
No data available
Phenotype
Phenotype resulting from CRISPR2-vsx1
No data available
Phenotype of all Fish created by or utilizing CRISPR2-vsx1
Phenotype Fish Conditions Figures
visual perception decreased process quality, abnormal vsx1upo371/upo371 standard conditions Fig. 2 with image from Letelier et al., 2023
eye decreased functionality, abnormal vsx1upo371/upo371 standard conditions Fig. 2 with image from Letelier et al., 2023
retinal inner plexiform layer hypoplastic, abnormal vsx1upo371/upo371; vsx2upo372/+ standard conditions Fig. 1 with image from Letelier et al., 2023
whole organism decreased life span, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions text only from Letelier et al., 2023
retinal inner nuclear layer vsx2 expression increased amount, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 5 - Supplemental 1 with image from Letelier et al., 2023
retinal outer plexiform layer disorganized, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 1 with image from Letelier et al., 2023
retina vsx2 expression increased amount, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 5 - Supplemental 1 with image from Letelier et al., 2023
retinal inner nuclear layer retinal bipolar neuron decreased amount, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 4 with image from Letelier et al., 2023
retina vsx1 expression increased amount, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 5 - Supplemental 1 with image from Letelier et al., 2023
whole organism vsx1 expression increased amount, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 5 with image from Letelier et al., 2023
whole organism vsx2 expression decreased amount, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 5 with image from Letelier et al., 2023
retinal inner nuclear layer decreased thickness, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 1 with image from Letelier et al., 2023
retinal outer nuclear layer increased thickness, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 1 with image from Letelier et al., 2023
visual perception decreased process quality, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 2 with image from Letelier et al., 2023
retina cell population proliferation increased occurrence, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 3 with image from Letelier et al., 2023
retinal inner nuclear layer vsx1 expression decreased amount, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 5 - Supplemental 1 with image from Letelier et al., 2023
retinal inner nuclear layer apoptotic process increased occurrence, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 3 with image from Letelier et al., 2023
ciliary marginal zone vsx2 expression increased amount, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 5 - Supplemental 1 with image from Letelier et al., 2023
retinal inner nuclear layer Muller cell increased amount, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 4 with image from Letelier et al., 2023
retinal inner plexiform layer disorganized, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 1 with image from Letelier et al., 2023
eye decreased functionality, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 2 with image from Letelier et al., 2023
optic cup vsx1 expression increased amount, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 5 - Supplemental 1 with image from Letelier et al., 2023
retinal inner nuclear layer retinal bipolar neuron prkcbb expression decreased amount, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 4 with image from Letelier et al., 2023
retinal inner nuclear layer Muller cell gfap expression increased amount, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 4 with image from Letelier et al., 2023
retinal outer plexiform layer structurally discontinuous, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 1 with image from Letelier et al., 2023
visually-mediated background adaptation process quality, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 1 with image from Letelier et al., 2023
retinal inner plexiform layer structurally discontinuous, abnormal vsx1upo371/upo371; vsx2upo372/upo372 standard conditions Fig. 1 with image from Letelier et al., 2023
Citations