CRISPR

CRISPR2-desma

ID
ZDB-CRISPR-240808-4
Name
CRISPR2-desma
Previous Names
None
Target
Sequence
5' - ATTCAGCCTCCGCCGAGTCGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
umu10 desma
Expression
Gene expression in Wild Types + CRISPR2-desma
No data available
Phenotype
Phenotype resulting from CRISPR2-desma
No data available
Phenotype of all Fish created by or utilizing CRISPR2-desma
Phenotype Fish Conditions Figures
extraocular musculature fhl2b expression increased amount, abnormal desmaumu10/umu10; desmbumu11/umu11 standard conditions Fig. 2 with image from Dennhag et al., 2024
extraocular musculature Ab-FHL2 labeling increased amount, abnormal desmaumu10/umu10; desmbumu11/umu11 standard conditions Fig. 2 with image from Dennhag et al., 2024
swimming behavior decreased rate, abnormal desmaumu10/umu10; desmbumu11/umu11; i135Tg/i135Tg standard conditions Fig. 1 with image from Dennhag et al., 2024
extraocular musculature cell death decreased frequency, abnormal desmaumu10/umu10; desmbumu11/umu11; i135Tg/i135Tg standard conditions Fig. 1 with image from Dennhag et al., 2024
trunk musculature slow muscle cell ratio trunk musculature fast muscle cell, abnormal desmaumu10/umu10; desmbumu11/umu11; i135Tg/i135Tg standard conditions Fig. 1 with image from Dennhag et al., 2024
trunk musculature EGFP expression spatial pattern, abnormal desmaumu10/umu10; desmbumu11/umu11; i135Tg/i135Tg standard conditions Fig. 1 with image from Dennhag et al., 2024
trunk musculature fast muscle cell ab-f310 labeling spatial pattern, abnormal desmaumu10/umu10; desmbumu11/umu11; i135Tg/i135Tg standard conditions Fig. 1 with image from Dennhag et al., 2024
trunk musculature slow muscle cell ab-s58 labeling spatial pattern, abnormal desmaumu10/umu10; desmbumu11/umu11; i135Tg/i135Tg standard conditions Fig. 1 with image from Dennhag et al., 2024
trunk musculature transition between slow and fast fiber decreased process quality, abnormal desmaumu10/umu10; desmbumu11/umu11; i135Tg/i135Tg standard conditions Fig. 1 with image from Dennhag et al., 2024
trunk musculature ab-pax7 labeling increased amount, abnormal desmaumu10/umu10; desmbumu11/umu11; i135Tg/i135Tg standard conditions Fig. 1 with image from Dennhag et al., 2024
trunk musculature twitch skeletal muscle contraction decreased process quality, abnormal desmaumu10/umu10; desmbumu11/umu11; i135Tg/i135Tg mechanical stress Fig. 1 with image from Dennhag et al., 2024
extraocular musculature muscle cell hypertrophic, abnormal fhl2bumu33/umu33; desmaumu10/umu10; desmbumu11/umu11 standard conditions Fig. 3 with image from Dennhag et al., 2024
extraocular musculature cell division increased frequency, abnormal fhl2aumu32/umu32; fhl2bumu33/umu33; desmaumu10/umu10; desmbumu11/umu11 standard conditions Fig. 3 with image from Dennhag et al., 2024
extraocular musculature muscle cell hypertrophic, abnormal fhl2aumu32/umu32; fhl2bumu33/umu33; desmaumu10/umu10; desmbumu11/umu11 standard conditions Fig. 3 with image from Dennhag et al., 2024
extraocular musculature cell death increased occurrence, abnormal fhl2aumu32/umu32; fhl2bumu33/umu33; desmaumu10/umu10; desmbumu11/umu11 standard conditions Fig. 3 with image from Dennhag et al., 2024
Citations