CRISPR

CRISPR10-egfl7

ID
ZDB-CRISPR-250127-2
Name
CRISPR10-egfl7
Previous Names
None
Target
Sequence
5' - GGTGATGTAGGGTTTGTGTAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
cq180 egfl7
Expression
Gene expression in Wild Types + CRISPR10-egfl7
No data available
Phenotype
Phenotype resulting from CRISPR10-egfl7
No data available
Phenotype of all Fish created by or utilizing CRISPR10-egfl7
Phenotype Fish Conditions Figures
brain lymphatic endothelial cell mrc1a expression decreased amount, abnormal egfl7cq180/cq180; cq10Tg/cq10Tg; cq27Tg/cq27Tg standard conditions Fig. 4 with image from Chen et al., 2024
brain lymphatic endothelial cell mrc1a expression decreased amount, abnormal egfl7cq180/cq180; cq10Tg/cq10Tg; cq27Tg/cq27Tg chemical treatment by environment: metronidazole Fig. 4 with image from Chen et al., 2024
brain lymphatic endothelial cell DsRed expression decreased amount, abnormal egfl7cq180/cq180; cq10Tg/cq10Tg; cq27Tg/cq27Tg chemical treatment by environment: metronidazole Fig. 2 with image,  Fig. 5 with image from Chen et al., 2024
brain lymphatic endothelial cell flt4 expression decreased amount, abnormal egfl7cq180/cq180; cq10Tg/cq10Tg; cq27Tg/cq27Tg chemical treatment by environment: metronidazole Fig. 4 with image from Chen et al., 2024
brain lymphatic endothelial cell flt4 expression decreased amount, abnormal egfl7cq180/cq180; cq10Tg/cq10Tg; cq27Tg/cq27Tg standard conditions Fig. 4 with image from Chen et al., 2024
brain lymphatic endothelial cell DsRed expression decreased amount, abnormal egfl7cq180/cq180; cq27Tg/cq27Tg standard conditions Fig. 5 with image,  Fig. 8 with image from Chen et al., 2024
brain lymphatic endothelial cell cell division decreased occurrence, abnormal egfl7cq180/cq180; cq27Tg/cq27Tg standard conditions Fig. 5 with image from Chen et al., 2024
head lymph vasculature EGFP expression decreased amount, abnormal egfl7cq180/cq180; cq27Tg/cq27Tg; cq86Tg/cq86Tg standard conditions Fig. 3 with image from Chen et al., 2024
brain lymphatic endothelial cell EGFP expression decreased amount, abnormal egfl7cq180/cq180; cq27Tg/cq27Tg; cq86Tg/cq86Tg standard conditions Fig. 3 with image from Chen et al., 2024
head lymph vasculature DsRed expression decreased amount, abnormal egfl7cq180/cq180; cq27Tg/cq27Tg; cq86Tg/cq86Tg standard conditions Fig. 3 with image from Chen et al., 2024
brain lymphatic endothelial cell DsRed expression decreased amount, abnormal egfl7cq180/cq180; cq27Tg/cq27Tg; cq86Tg/cq86Tg standard conditions Fig. 3 with image from Chen et al., 2024
head lymph vasculature DsRed expression decreased amount, abnormal egfl7cq180/cq180; cq27Tg/cq27Tg; s843Tg/s843Tg standard conditions Fig. 3 with image from Chen et al., 2024
brain lymphatic endothelial cell DsRed expression decreased amount, abnormal egfl7cq180/cq180; cq27Tg/cq27Tg; s843Tg/s843Tg standard conditions Fig. 3 with image from Chen et al., 2024
head lymph vasculature DsRed expression amount, ameliorated egfl7cq180/cq180; cq182Tg/cq182Tg; cq27Tg/cq27Tg standard conditions Fig. 3 with image from Chen et al., 2024
brain lymphatic endothelial cell DsRed expression amount, ameliorated egfl7cq180/cq180; cq182Tg/cq182Tg; cq27Tg/cq27Tg standard conditions Fig. 3 with image from Chen et al., 2024
brain lymphatic endothelial cell DsRed expression amount, ameliorated egfl7cq180/cq180; cq183Tg/cq183Tg; cq27Tg/cq27Tg standard conditions Fig. 3 with image from Chen et al., 2024
head lymph vasculature DsRed expression amount, ameliorated egfl7cq180/cq180; cq183Tg/cq183Tg; cq27Tg/cq27Tg standard conditions Fig. 3 with image from Chen et al., 2024
brain lymphatic endothelial cell EGFP expression amount, ameliorated egfl7cq180/cq180; cq183Tg/cq183Tg; cq27Tg/cq27Tg standard conditions Fig. 3 with image from Chen et al., 2024
head lymph vasculature EGFP expression amount, ameliorated egfl7cq180/cq180; cq183Tg/cq183Tg; cq27Tg/cq27Tg standard conditions Fig. 3 with image from Chen et al., 2024
brain lymphatic endothelial cell integrin-mediated signaling pathway decreased occurrence, abnormal egfl7cq180/cq180; ilkcq187/+; cq27Tg/cq27Tg standard conditions Fig. 8 with image from Chen et al., 2024
brain lymphatic endothelial cell DsRed expression amount, ameliorated egfl7cq180/cq180; ilkcq187/+; cq27Tg/cq27Tg standard conditions Fig. 8 with image from Chen et al., 2024
Citations