CRISPR

CRISPR1-rfc2

ID
ZDB-CRISPR-250410-4
Name
CRISPR1-rfc2
Previous Names
None
Target
Sequence
5' - AGCTGACGGACCGCCTAAAAAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ck179a rfc2
ck179b rfc2
ck179c rfc2
Expression
Gene expression in Wild Types + CRISPR1-rfc2
No data available
Phenotype
Phenotype resulting from CRISPR1-rfc2
No data available
Phenotype of all Fish created by or utilizing CRISPR1-rfc2
Phenotype Fish Conditions Figures
midbrain apoptotic process increased occurrence, abnormal rfc2ck179a/ck179a standard conditions Fig. 4 with image from Park et al., 2024
Meckel's cartilage decreased length, abnormal rfc2ck179a/ck179a standard conditions Fig. 5 with image from Park et al., 2024
head decreased size, abnormal rfc2ck179a/ck179a standard conditions Fig. 3 with image from Park et al., 2024
ventral mandibular arch morphology, abnormal rfc2ck179a/ck179a standard conditions Fig. 5 with image from Park et al., 2024
ceratobranchial cartilage morphology, abnormal rfc2ck179a/ck179a standard conditions Fig. 5 with image from Park et al., 2024
opercle morphology, abnormal rfc2ck179a/ck179a standard conditions Fig. 5 with image from Park et al., 2024
branchiostegal ray 1 morphology, abnormal rfc2ck179a/ck179a standard conditions Fig. 5 with image from Park et al., 2024
torus semicircularis tcf7l2 expression decreased amount, abnormal rfc2ck179a/ck179a standard conditions Fig. S4 from Park et al., 2024
maxilla morphology, abnormal rfc2ck179a/ck179a standard conditions Fig. 5 with image from Park et al., 2024
cranial cartilage morphology, abnormal rfc2ck179a/ck179a standard conditions Fig. 5 with image from Park et al., 2024
midbrain hindbrain boundary apoptotic process increased occurrence, abnormal rfc2ck179a/ck179a standard conditions Fig. 4 with image from Park et al., 2024
retina apoptotic process increased occurrence, abnormal rfc2ck179a/ck179a standard conditions Fig. 4 with image from Park et al., 2024
eye decreased size, abnormal rfc2ck179a/ck179a standard conditions Fig. 3 with image from Park et al., 2024
brain tp53 expression increased amount, abnormal rfc2ck179a/ck179a standard conditions Fig. 4 with image from Park et al., 2024
ceratobranchial 5 tooth morphology, abnormal rfc2ck179a/ck179a standard conditions Fig. 5 with image from Park et al., 2024
Meckel's cartilage increased angle to Meckel's cartilage, abnormal rfc2ck179a/ck179a standard conditions Fig. 5 with image from Park et al., 2024
mandibular arch skeleton morphology, abnormal rfc2ck179a/ck179a standard conditions Fig. 5 with image from Park et al., 2024
entopterygoid morphology, abnormal rfc2ck179a/ck179a standard conditions Fig. 5 with image from Park et al., 2024
brain decreased size, abnormal rfc2ck179a/ck179a standard conditions Fig. 3 with image from Park et al., 2024
optic tectum tcf7l2 expression decreased amount, abnormal rfc2ck179a/ck179a standard conditions Fig. S4 from Park et al., 2024
brain apoptotic, abnormal rfc2ck179a/ck179a standard conditions Fig. 4 with image from Park et al., 2024
whole organism lethal (sensu genetics), abnormal rfc2ck179a/ck179a standard conditions text only from Park et al., 2024
whole organism viability, abnormal rfc2ck179a/ck179a standard conditions text only from Park et al., 2024
optic tectum her4.1 expression decreased amount, abnormal rfc2ck179a/ck179a standard conditions Fig. S4 from Park et al., 2024
positive phototaxis decreased occurrence, abnormal rfc2ck179a/+ standard conditions Fig. 6 with image from Park et al., 2024
adult locomotory behavior decreased occurrence, abnormal rfc2ck179a/+ standard conditions Fig. 6 with image from Park et al., 2024
locomotory exploration behavior decreased occurrence, abnormal rfc2ck179a/+ standard conditions Fig. 6 with image from Park et al., 2024
social behavior increased occurrence, abnormal rfc2ck179a/+ standard conditions Fig. 6 with image from Park et al., 2024
aortic arch morphology, abnormal rfc2ck179a/ck179a; s843Tg standard conditions Fig. 5 with image from Park et al., 2024
aortic arch decreased diameter, abnormal rfc2ck179a/ck179a; s843Tg standard conditions Fig. 5 with image from Park et al., 2024
Citations