CRISPR

CRISPR4-dgat1a

ID

ZDB-CRISPR-250430-8

Name

CRISPR4-dgat1a

Previous Names

None

Target

dgat1a (1)

Sequence

5' - GGGACTCAAGCCAAACGCGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The first two "G"s were added.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
c770	dgat1a

Expression

Gene expression in Wild Types + CRISPR4-dgat1a

No data available

Phenotype

Phenotype resulting from CRISPR4-dgat1a

No data available

Phenotype of all Fish created by or utilizing CRISPR4-dgat1a

Phenotype	Fish	Conditions	Figures
yolk syncytial layer lipid droplet increased amount, abnormal	dgat1a^c770/c770; dgat2^c765/c765; dgat1b^c773/c773	standard conditions	Figure 8 from Wilson et al., 2024
yolk syncytial layer opaque, abnormal	dgat1a^c770/c770; dgat2^c765/c765; dgat1b^c773/c773	standard conditions	Figure 8 from Wilson et al., 2024
yolk syncytial layer opaque, abnormal	dgat2^sa13945/+; dgat1a^c770/c770; dgat2^c765/+; dgat1b^c773/c773	standard conditions	Figure 8 from Wilson et al., 2024
whole organism dgat1a expression decreased amount, abnormal	dgat2^{sa13945/sa13945}; dgat1a^c770/c770; dgat1b^c773/c773	standard conditions	Figure 5 from Wilson et al., 2024
yolk syncytial layer opaque, exacerbated	dgat2^{sa13945/sa13945}; dgat1a^c770/c770; dgat1b^c773/c773	standard conditions	Figure 5 from Wilson et al., 2024
whole organism mogat3b expression decreased amount, abnormal	dgat2^{sa13945/sa13945}; dgat1a^c770/c770; dgat1b^c773/c773	standard conditions	Figure 6 from Wilson et al., 2024
whole organism dgat1b expression decreased amount, abnormal	dgat2^{sa13945/sa13945}; dgat1a^c770/c770; dgat1b^c773/c773	standard conditions	Figure 5 from Wilson et al., 2024
whole organism decreased size, abnormal	dgat1a^c770/c770; dgat2^c765/c765; mogat3b^c858/c858; dgat1b^c773/c773	standard conditions	Figure 8 from Wilson et al., 2024
yolk syncytial layer opaque, abnormal	dgat1a^c770/c770; dgat2^c765/c765; mogat3b^c858/c858; dgat1b^c773/c773	standard conditions	Figure 8 from Wilson et al., 2024
yolk syncytial layer edematous, abnormal	dgat1a^c770/c770; dgat2^c765/c765; mogat3b^c858/c858; dgat1b^c773/c773	standard conditions	Figure 8 from Wilson et al., 2024
whole organism decreased size, abnormal	dgat2^{sa13945/sa13945}; dgat1a^c770/+; mogat3b^c858/c858; dgat1b^c773/c773	standard conditions	Figure 8 from Wilson et al., 2024
extension malformed, abnormal	dgat2^{sa13945/sa13945}; dgat1a^c770/+; mogat3b^c858/c858; dgat1b^c773/c773	standard conditions	Figure 8 from Wilson et al., 2024
whole organism decreased size, abnormal	dgat2^{sa13945/sa13945}; dgat1a^c770/c770; mogat3b^c858/c858; dgat1b^c773/+	standard conditions	Figure 8 from Wilson et al., 2024
extension malformed, abnormal	dgat2^{sa13945/sa13945}; dgat1a^c770/c770; mogat3b^c858/c858; dgat1b^c773/+	standard conditions	Figure 8 from Wilson et al., 2024
whole organism decreased size, abnormal	dgat2^{sa13945/sa13945}; dgat1a^c770/c770; mogat3b^c858/c858; dgat1b^c773/c773	standard conditions	Figure 8 from Wilson et al., 2024
yolk syncytial layer opaque, abnormal	dgat2^{sa13945/sa13945}; dgat1a^c770/c770; mogat3b^c858/c858; dgat1b^c773/c773	standard conditions	Figure 8 from Wilson et al., 2024
yolk syncytial layer edematous, abnormal	dgat2^{sa13945/sa13945}; dgat1a^c770/c770; mogat3b^c858/c858; dgat1b^c773/c773	standard conditions	Figure 8 from Wilson et al., 2024
extension malformed, abnormal	dgat2^{sa13945/sa13945}; dgat1a^c770/c770; mogat3b^c858/c858; dgat1b^c773/c773	standard conditions	Figure 8 from Wilson et al., 2024

Citations