CRISPR

CRISPR6-spout1

ID
ZDB-CRISPR-250729-1
Name
CRISPR6-spout1
Previous Names
None
Target
Sequence
5' - TCCAGAGCTGCGGACGTATCTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR6-spout1
No data available
Phenotype
Phenotype resulting from CRISPR6-spout1
No data available
Phenotype of all Fish created by or utilizing CRISPR6-spout1
Phenotype Fish Conditions Figures
whole organism bmb expression decreased amount, abnormal WT + CRISPR4-spout1 + CRISPR6-spout1 control Table 3 from Liu et al., 2024
whole organism jac8 expression decreased amount, abnormal WT + CRISPR4-spout1 + CRISPR6-spout1 control Table 3 from Liu et al., 2024
whole organism rchy1 expression decreased amount, abnormal WT + CRISPR4-spout1 + CRISPR6-spout1 control Table 3 from Liu et al., 2024
whole organism kif3a expression decreased amount, abnormal WT + CRISPR4-spout1 + CRISPR6-spout1 control Table 3 from Liu et al., 2024
whole organism gabrp expression decreased amount, abnormal WT + CRISPR4-spout1 + CRISPR6-spout1 control Table 3 from Liu et al., 2024
whole organism sybl1 expression decreased amount, abnormal WT + CRISPR4-spout1 + CRISPR6-spout1 control Table 3 from Liu et al., 2024
whole organism rps27l expression decreased amount, abnormal WT + CRISPR4-spout1 + CRISPR6-spout1 control Table 3 from Liu et al., 2024
whole organism zgc:153846 expression decreased amount, abnormal WT + CRISPR4-spout1 + CRISPR6-spout1 control Table 3 from Liu et al., 2024
whole organism prkrip1 expression decreased amount, abnormal WT + CRISPR4-spout1 + CRISPR6-spout1 control Table 3 from Liu et al., 2024
whole organism c4b expression decreased amount, abnormal WT + CRISPR4-spout1 + CRISPR6-spout1 control Table 3 from Liu et al., 2024
whole organism jac9 expression decreased amount, abnormal WT + CRISPR4-spout1 + CRISPR6-spout1 control Table 3 from Liu et al., 2024
whole organism si:ch73-329n5.1 expression decreased amount, abnormal WT + CRISPR4-spout1 + CRISPR6-spout1 control Table 3 from Liu et al., 2024
whole organism rnd2 expression decreased amount, abnormal WT + CRISPR4-spout1 + CRISPR6-spout1 control Table 3 from Liu et al., 2024
whole organism kcnj1a.6 expression decreased amount, abnormal WT + CRISPR4-spout1 + CRISPR6-spout1 control Table 3 from Liu et al., 2024
whole organism ap3d1 expression decreased amount, abnormal WT + CRISPR4-spout1 + CRISPR6-spout1 control Table 3 from Liu et al., 2024
whole organism c3a.2 expression decreased amount, abnormal WT + CRISPR4-spout1 + CRISPR6-spout1 control Table 3 from Liu et al., 2024
whole organism spout1 expression decreased amount, abnormal WT + CRISPR4-spout1 + CRISPR6-spout1 control Table 3 from Liu et al., 2024
whole organism acp5a expression decreased amount, abnormal WT + CRISPR4-spout1 + CRISPR6-spout1 control Table 3 from Liu et al., 2024
optic tectum action potential initiation increased process quality, abnormal WT + CRISPR4-spout1 + CRISPR6-spout1 control Fig. 4 with image from Liu et al., 2024
Citations