CRISPR

CRISPR1-naxd

ID
ZDB-CRISPR-260320-3
Name
CRISPR1-naxd
Previous Names
None
Target
Sequence
5' - CACAGTGTGGTTGTGGGACC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
lux6 naxd
Expression
Gene expression in Wild Types + CRISPR1-naxd
No data available
Phenotype
Phenotype resulting from CRISPR1-naxd
No data available
Phenotype of all Fish created by or utilizing CRISPR1-naxd
Phenotype Fish Conditions Figures
whole organism viability, ameliorated naxdlux6/lux6 (AB) chemical treatment by environment: nicotinic acid FIGURE 5 with image from Patraskaki et al., 2026
brain microglial cell increased amount, abnormal naxdlux6/lux6 (AB) standard conditions FIGURE 4 with image from Patraskaki et al., 2026
swimming decreased process quality, abnormal naxdlux6/lux6 (AB) control FIGURE 5 with image from Patraskaki et al., 2026
whole organism (R)-NADHX increased amount, abnormal naxdlux6/lux6 (AB) chemical treatment by environment: nicotinic acid FIGURE 5 with image from Patraskaki et al., 2026
whole organism NAD(+) decreased amount, abnormal naxdlux6/lux6 (AB) standard conditions FIGURE 2 with image from Patraskaki et al., 2026
whole organism increased length, abnormal naxdlux6/lux6 (AB) control FIGURE 3 with image from Patraskaki et al., 2026
whole organism NADH amount, ameliorated naxdlux6/lux6 (AB) chemical treatment by environment: nicotinic acid FIGURE 5 with image from Patraskaki et al., 2026
whole organism p2ry12 expression decreased amount, abnormal naxdlux6/lux6 (AB) standard conditions FIGURE 4 with image from Patraskaki et al., 2026
whole organism NADPH decreased amount, abnormal naxdlux6/lux6 (AB) standard conditions FIGURE 2 with image from Patraskaki et al., 2026
whole organism mpeg1.1 expression increased amount, abnormal naxdlux6/lux6 (AB) standard conditions FIGURE 4 with image from Patraskaki et al., 2026
head decreased length, abnormal naxdlux6/lux6 (AB) control FIGURE 3 with image from Patraskaki et al., 2026
whole organism il6 expression increased amount, abnormal naxdlux6/lux6 (AB) standard conditions FIGURE 4 with image from Patraskaki et al., 2026
swimming decreased linear velocity, abnormal naxdlux6/lux6 (AB) control FIGURE 3 with image from Patraskaki et al., 2026
whole organism decreased length, abnormal naxdlux6/lux6 (AB) control FIGURE 3 with image from Patraskaki et al., 2026
whole organism p2ry12 expression increased amount, abnormal naxdlux6/lux6 (AB) standard conditions FIGURE 4 with image from Patraskaki et al., 2026
whole organism naxd expression decreased amount, abnormal naxdlux6/lux6 (AB) standard conditions FIGURE 2 with image from Patraskaki et al., 2026
whole organism tnfb expression increased amount, abnormal naxdlux6/lux6 (AB) standard conditions FIGURE 4 with image from Patraskaki et al., 2026
whole organism mpeg1.1 expression decreased amount, abnormal naxdlux6/lux6 (AB) standard conditions FIGURE 4 with image from Patraskaki et al., 2026
whole organism dead, abnormal naxdlux6/lux6 (AB) standard conditions FIGURE 3 with image,  FIGURE 5 with image from Patraskaki et al., 2026
swimming process quality, ameliorated naxdlux6/lux6 (AB) chemical treatment by environment: nicotinic acid FIGURE 5 with image from Patraskaki et al., 2026
whole organism naxe expression decreased amount, abnormal naxdlux6/lux6 (AB) standard conditions FIGURE 2 with image from Patraskaki et al., 2026
whole organism (S)-NADHX increased amount, abnormal naxdlux6/lux6 (AB) standard conditions FIGURE 2 with image from Patraskaki et al., 2026
whole organism dead, abnormal naxdlux6/lux6 (AB) chemical treatment by environment: nicotinic acid FIGURE 5 with image from Patraskaki et al., 2026
whole organism il10 expression increased amount, abnormal naxdlux6/lux6 (AB) standard conditions FIGURE 4 with image from Patraskaki et al., 2026
whole organism tnfa expression increased amount, abnormal naxdlux6/lux6 (AB) standard conditions FIGURE 4 with image from Patraskaki et al., 2026
whole organism il1b expression increased amount, abnormal naxdlux6/lux6 (AB) standard conditions FIGURE 4 with image from Patraskaki et al., 2026
whole organism NADH decreased amount, abnormal naxdlux6/lux6 (AB) standard conditions FIGURE 2 with image,  FIGURE 5 with image from Patraskaki et al., 2026
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to report issues or recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.