CRISPR

CRISPR1-supt16h

ID

ZDB-CRISPR-260415-2

Name

CRISPR1-supt16h

Previous Names

None

Target

supt16h (1)

Sequence

5' - TCAGAATGAGATGACTGCTGAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
kan1	supt16h

Expression

Gene expression in Wild Types + CRISPR1-supt16h

No data available

Phenotype

Phenotype resulting from CRISPR1-supt16h

No data available

Phenotype of all Fish created by or utilizing CRISPR1-supt16h

Phenotype	Fish	Conditions	Figures
oligodendrocyte mbpa expression decreased distribution, abnormal	supt16h^kan1/kan1 (AB)	standard conditions	Fig. 5 from Lee et al., 2026
whole organism olig2 expression decreased amount, abnormal	supt16h^kan1/kan1 (AB)	control	Fig. 5 from Lee et al., 2026
head decreased size, abnormal	supt16h^kan1/kan1 (AB)	standard conditions	Fig. 2 from Lee et al., 2026
whole organism decreased length, abnormal	supt16h^kan1/kan1 (AB)	standard conditions	Fig. 2 from Lee et al., 2026
spinal cord apoptotic process increased process quality, abnormal	supt16h^kan1/kan1 (AB)	standard conditions	Fig. 2 , Fig. 4 from Lee et al., 2026
head decreased length, abnormal	supt16h^kan1/kan1 (AB)	control	Fig. 3 , Fig. 4 from Lee et al., 2026
myelinating Schwann cell mbpa expression decreased distribution, abnormal	supt16h^kan1/kan1 (AB)	standard conditions	Fig. 5 from Lee et al., 2026
pharyngeal arch apoptotic process increased process quality, abnormal	supt16h^kan1/kan1 (AB)	standard conditions	Fig. 2 , Fig. 4 from Lee et al., 2026
pharyngeal arch cranial neural crest cell dlx2a expression decreased distribution, abnormal	supt16h^kan1/kan1 (AB)	standard conditions	Fig. 5 from Lee et al., 2026
migratory neural crest cell crestin expression decreased distribution, abnormal	supt16h^kan1/kan1 (AB)	standard conditions	Fig. 5 from Lee et al., 2026
brain axon ab1-tuba labeling spatial pattern, abnormal	supt16h^kan1/kan1 (AB)	standard conditions	Fig. 2 from Lee et al., 2026
brain axon structurally discontinuous, abnormal	supt16h^kan1/kan1 (AB)	standard conditions	Fig. 2 from Lee et al., 2026
whole organism dead, abnormal	supt16h^kan1/kan1 (AB)	standard conditions	text only from Lee et al., 2026
brain apoptotic process increased process quality, abnormal	supt16h^kan1/kan1 (AB)	standard conditions	Fig. 2 , Fig. 4 from Lee et al., 2026
post-vent region kinked, abnormal	supt16h^kan1/kan1 (AB)	standard conditions	Fig. 2 from Lee et al., 2026
pharyngeal arch neural crest cell differentiation decreased process quality, abnormal	supt16h^kan1/kan1 (AB)	standard conditions	Fig. 5 from Lee et al., 2026
post-vent region curved, abnormal	supt16h^kan1/kan1 (AB)	standard conditions	Fig. 2 from Lee et al., 2026
ball edematous, abnormal	supt16h^kan1/kan1 (AB)	standard conditions	Fig. 2 from Lee et al., 2026
thigmotaxis process quality, abnormal	supt16h^kan1/kan1 (AB)	control	Fig. 2 , Fig. 3 from Lee et al., 2026
brain decreased size, abnormal	supt16h^kan1/kan1 (AB)	control	Fig. 3 from Lee et al., 2026
trunk decreased length, abnormal	supt16h^kan1/kan1 (AB)	control	Fig. 3 , Fig. 4 from Lee et al., 2026
oligodendrocyte olig2 expression decreased distribution, abnormal	supt16h^kan1/kan1 (AB)	standard conditions	Fig. 5 from Lee et al., 2026
head decreased size, abnormal	supt16h^sd45/+; supt16h^kan1/+ (AB)	standard conditions	Fig. 2 from Lee et al., 2026
whole organism decreased length, abnormal	supt16h^sd45/+; supt16h^kan1/+ (AB)	standard conditions	Fig. 2 from Lee et al., 2026
post-vent region kinked, abnormal	supt16h^sd45/+; supt16h^kan1/+ (AB)	standard conditions	Fig. 2 from Lee et al., 2026
post-vent region curved, abnormal	supt16h^sd45/+; supt16h^kan1/+ (AB)	standard conditions	Fig. 2 from Lee et al., 2026
ball edematous, abnormal	supt16h^sd45/+; supt16h^kan1/+ (AB)	standard conditions	Fig. 2 from Lee et al., 2026
head length, ameliorated	supt16h^kan1/kan1 + MO4-tp53 (AB)	control	Fig. 4 from Lee et al., 2026
brain apoptotic process process quality, ameliorated	supt16h^kan1/kan1 + MO4-tp53 (AB)	control	Fig. 4 from Lee et al., 2026
trunk decreased length, abnormal	supt16h^kan1/kan1 + MO4-tp53 (AB)	control	Fig. 4 from Lee et al., 2026
pharyngeal arch apoptotic process process quality, ameliorated	supt16h^kan1/kan1 + MO4-tp53 (AB)	control	Fig. 4 from Lee et al., 2026
spinal cord apoptotic process process quality, ameliorated	supt16h^kan1/kan1 + MO4-tp53 (AB)	control	Fig. 4 from Lee et al., 2026

Citations