CRISPR

CRISPR1-pmpcb

ID
ZDB-CRISPR-260623-1
Name
CRISPR1-pmpcb
Previous Names
None
Target
Sequence
5' - GGGAGAAGCCGAGATCGAGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hza18 pmpcb
hza21 pmpcb
hza22 pmpcb
Expression
Gene expression in Wild Types + CRISPR1-pmpcb
No data available
Phenotype
Phenotype resulting from CRISPR1-pmpcb
No data available
Phenotype of all Fish created by or utilizing CRISPR1-pmpcb
Phenotype Fish Conditions Figures
central nervous system glial cell vim expression decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 4 with image,  Fig. 6 with image,  Fig. 7 with image,  Fig. 8 with image from Jing et al., 2026
eye ab4-h2afx labeling increased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 4 with image from Jing et al., 2026
brain hspa5 expression amount, ameliorated pmpcbhza21/hza21 chemical treatment by environment: 4-phenylbutyric acid Fig. 7 with image from Jing et al., 2026
brain hspa5 expression increased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 7 with image from Jing et al., 2026
head Ab3-canx labeling increased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 7 with image from Jing et al., 2026
head axin2 expression decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 5 with image,  Fig. 8 with image from Jing et al., 2026
head ab9-eif2a labeling amount, ameliorated pmpcbhza21/hza21 chemical treatment by environment: 4-phenylbutyric acid Fig. 7 with image from Jing et al., 2026
head Ab1-LIAS labeling decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 3 with image,  Fig. 8 with image from Jing et al., 2026
head ab4-h2afx labeling increased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 4 with image from Jing et al., 2026
head Ab10-bcl2 labeling decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 4 with image from Jing et al., 2026
head Ab2-atf4 labeling amount, ameliorated pmpcbhza21/hza21 chemical treatment by environment: 4-phenylbutyric acid Fig. 7 with image from Jing et al., 2026
brain mitochondrion increased size, abnormal pmpcbhza21/hza21 standard conditions Fig. 3 with image from Jing et al., 2026
brain mitochondrion swollen, abnormal pmpcbhza21/hza21 standard conditions Fig. 3 with image from Jing et al., 2026
central nervous system glial cell axin2 expression amount, ameliorated pmpcbhza21/hza21 chemical treatment by environment: creatine Fig. 6 with image from Jing et al., 2026
head ab9-eif2a labeling increased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 7 with image from Jing et al., 2026
head Ab2-mt-co1 labeling decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 3 with image from Jing et al., 2026
central nervous system glial cell axin2 expression decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 6 with image,  Fig. 8 with image from Jing et al., 2026
head Ab3-canx labeling amount, ameliorated pmpcbhza21/hza21 chemical treatment by environment: 4-phenylbutyric acid Fig. 7 with image from Jing et al., 2026
brain ab4-h2afx labeling increased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 4 with image from Jing et al., 2026
brain eif2ak3 expression increased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 7 with image from Jing et al., 2026
central nervous system glial cell gfap expression amount, ameliorated pmpcbhza21/hza21 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 6 with image from Jing et al., 2026
eye proliferative region increased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 4 with image from Jing et al., 2026
head Ab36-ctnnb labeling decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 5 with image,  Fig. 8 with image from Jing et al., 2026
central nervous system glial cell gfap expression decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 6 with image,  Fig. 7 with image,  Fig. 8 with image from Jing et al., 2026
head regulation of mitochondrial membrane potential decreased process quality, abnormal pmpcbhza21/hza21 standard conditions Fig. 3 with image from Jing et al., 2026
midbrain neuron decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 1 with image from Jing et al., 2026
brain mitochondrion circular, abnormal pmpcbhza21/hza21 standard conditions Fig. 3 with image from Jing et al., 2026
brain Ab19-sox2 labeling decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 4 with image from Jing et al., 2026
head ATP decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 3 with image from Jing et al., 2026
brain proliferative region increased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 4 with image from Jing et al., 2026
head Ab2-atf4 labeling increased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 7 with image from Jing et al., 2026
larval locomotory behavior decreased rate, abnormal pmpcbhza21/hza21 standard conditions Fig. 1 with image from Jing et al., 2026
brain ern1 expression increased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 7 with image from Jing et al., 2026
central nervous system glial cell vim expression amount, ameliorated pmpcbhza21/hza21 chemical treatment by environment: 4-phenylbutyric acid Fig. 7 with image from Jing et al., 2026
head Ab26-tp53 labeling increased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 4 with image from Jing et al., 2026
brain mitochondrial matrix decreased object quality, abnormal pmpcbhza21/hza21 standard conditions Fig. 3 with image from Jing et al., 2026
neuronal stem cell sox2 expression decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 2 with image from Jing et al., 2026
neuronal stem cell Ab19-sox2 labeling decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 2 with image from Jing et al., 2026
head ab8-ctnnb labeling decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 5 with image,  Fig. 8 with image from Jing et al., 2026
reactive oxygen species biosynthetic process increased occurrence, ameliorated pmpcbhza21/hza21 chemical treatment by environment: N-acetyl-L-cysteine Fig. 7 with image from Jing et al., 2026
brain ab8-ctnnb labeling decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 5 with image from Jing et al., 2026
brain Ab32-GFAP labeling decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 5 with image from Jing et al., 2026
central nervous system glial cell gfap expression amount, ameliorated pmpcbhza21/hza21 chemical treatment by environment: creatine Fig. 6 with image from Jing et al., 2026
head Ab1-CLPP labeling increased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 3 with image from Jing et al., 2026
central nervous system glial cell vim expression amount, ameliorated pmpcbhza21/hza21 chemical treatment by environment: creatine Fig. 6 with image from Jing et al., 2026
head DNA damage response increased occurrence, abnormal pmpcbhza21/hza21 standard conditions Fig. 4 with image from Jing et al., 2026
head ab8-eif2a labeling amount, ameliorated pmpcbhza21/hza21 chemical treatment by environment: 4-phenylbutyric acid Fig. 7 with image from Jing et al., 2026
eye Ab32-GFAP labeling decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 5 with image from Jing et al., 2026
glial cell gfap expression decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 2 with image from Jing et al., 2026
head Ab32-GFAP labeling decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 8 with image from Jing et al., 2026
brain ern1 expression amount, ameliorated pmpcbhza21/hza21 chemical treatment by environment: 4-phenylbutyric acid Fig. 7 with image from Jing et al., 2026
head Ab6-hspd1 labeling decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 3 with image,  Fig. 8 with image from Jing et al., 2026
central nervous system glial cell vim expression amount, ameliorated pmpcbhza21/hza21 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 6 with image from Jing et al., 2026
central nervous system glial cell gfap expression amount, ameliorated pmpcbhza21/hza21 chemical treatment by environment: 4-phenylbutyric acid Fig. 7 with image from Jing et al., 2026
head cell division increased occurrence, abnormal pmpcbhza21/hza21 standard conditions Fig. 4 with image from Jing et al., 2026
head Ab27-casp3 labeling increased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 4 with image from Jing et al., 2026
spinal cord myelination decreased occurrence, abnormal pmpcbhza21/hza21 standard conditions Fig. 1 with image from Jing et al., 2026
head Ab19-sox2 labeling decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 8 with image from Jing et al., 2026
brain eif2ak3 expression amount, ameliorated pmpcbhza21/hza21 chemical treatment by environment: 4-phenylbutyric acid Fig. 7 with image from Jing et al., 2026
reactive oxygen species biosynthetic process increased occurrence, abnormal pmpcbhza21/hza21 standard conditions Fig. 7 with image from Jing et al., 2026
glial cell mbpa expression decreased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 2 with image from Jing et al., 2026
head ab8-eif2a labeling increased amount, abnormal pmpcbhza21/hza21 standard conditions Fig. 7 with image from Jing et al., 2026
central nervous system glial cell vim expression decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 4 with image,  Fig. 6 with image,  Fig. 7 with image,  Fig. 8 with image from Jing et al., 2026
head axin2 expression decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 5 with image,  Fig. 8 with image from Jing et al., 2026
brain hspa5 expression amount, ameliorated pmpcbhza22/hza22 chemical treatment by environment: 4-phenylbutyric acid Fig. 7 with image from Jing et al., 2026
eye ab4-h2afx labeling increased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 4 with image from Jing et al., 2026
larval locomotory behavior decreased rate, abnormal pmpcbhza22/hza22 standard conditions Fig. 1 with image from Jing et al., 2026
brain hspa5 expression increased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 7 with image from Jing et al., 2026
head ab9-eif2a labeling amount, ameliorated pmpcbhza22/hza22 chemical treatment by environment: 4-phenylbutyric acid Fig. 7 with image from Jing et al., 2026
head Ab3-canx labeling increased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 7 with image from Jing et al., 2026
head Ab1-LIAS labeling decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 3 with image,  Fig. 8 with image from Jing et al., 2026
head Ab2-atf4 labeling amount, ameliorated pmpcbhza22/hza22 chemical treatment by environment: 4-phenylbutyric acid Fig. 7 with image from Jing et al., 2026
head Ab10-bcl2 labeling decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 4 with image from Jing et al., 2026
brain mitochondrion increased size, abnormal pmpcbhza22/hza22 standard conditions Fig. 3 with image from Jing et al., 2026
head ab9-eif2a labeling increased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 7 with image from Jing et al., 2026
central nervous system glial cell axin2 expression amount, ameliorated pmpcbhza22/hza22 chemical treatment by environment: creatine Fig. 6 with image from Jing et al., 2026
brain mitochondrion swollen, abnormal pmpcbhza22/hza22 standard conditions Fig. 3 with image from Jing et al., 2026
brain ab4-h2afx labeling increased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 4 with image from Jing et al., 2026
central nervous system glial cell axin2 expression decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 6 with image,  Fig. 8 with image from Jing et al., 2026
head Ab3-canx labeling amount, ameliorated pmpcbhza22/hza22 chemical treatment by environment: 4-phenylbutyric acid Fig. 7 with image from Jing et al., 2026
brain eif2ak3 expression increased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 7 with image from Jing et al., 2026
head Ab2-mt-co1 labeling decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 3 with image from Jing et al., 2026
central nervous system glial cell gfap expression amount, ameliorated pmpcbhza22/hza22 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 6 with image from Jing et al., 2026
head Ab36-ctnnb labeling decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 5 with image,  Fig. 8 with image from Jing et al., 2026
central nervous system glial cell gfap expression decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 6 with image,  Fig. 7 with image from Jing et al., 2026
midbrain neuron decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 1 with image from Jing et al., 2026
brain mitochondrion circular, abnormal pmpcbhza22/hza22 standard conditions Fig. 3 with image from Jing et al., 2026
head regulation of mitochondrial membrane potential decreased process quality, abnormal pmpcbhza22/hza22 standard conditions Fig. 3 with image from Jing et al., 2026
eye proliferative region increased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 4 with image from Jing et al., 2026
head ab4-h2afx labeling increased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 4 with image from Jing et al., 2026
brain Ab19-sox2 labeling decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 4 with image from Jing et al., 2026
head ATP decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 3 with image from Jing et al., 2026
brain proliferative region increased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 4 with image from Jing et al., 2026
head Ab2-atf4 labeling increased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 7 with image from Jing et al., 2026
brain ern1 expression increased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 7 with image from Jing et al., 2026
central nervous system glial cell vim expression amount, ameliorated pmpcbhza22/hza22 chemical treatment by environment: 4-phenylbutyric acid Fig. 7 with image from Jing et al., 2026
brain mitochondrial matrix decreased object quality, abnormal pmpcbhza22/hza22 standard conditions Fig. 3 with image from Jing et al., 2026
head Ab26-tp53 labeling increased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 4 with image from Jing et al., 2026
neuronal stem cell sox2 expression decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 2 with image from Jing et al., 2026
neuronal stem cell Ab19-sox2 labeling decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 2 with image from Jing et al., 2026
head ab8-ctnnb labeling decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 5 with image,  Fig. 8 with image from Jing et al., 2026
reactive oxygen species biosynthetic process increased occurrence, ameliorated pmpcbhza22/hza22 chemical treatment by environment: N-acetyl-L-cysteine Fig. 7 with image from Jing et al., 2026
brain ab8-ctnnb labeling decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 5 with image from Jing et al., 2026
brain Ab32-GFAP labeling decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 5 with image from Jing et al., 2026
head Ab1-CLPP labeling increased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 3 with image from Jing et al., 2026
central nervous system glial cell gfap expression amount, ameliorated pmpcbhza22/hza22 chemical treatment by environment: creatine Fig. 6 with image from Jing et al., 2026
central nervous system glial cell vim expression amount, ameliorated pmpcbhza22/hza22 chemical treatment by environment: creatine Fig. 6 with image from Jing et al., 2026
head DNA damage response increased occurrence, abnormal pmpcbhza22/hza22 standard conditions Fig. 4 with image from Jing et al., 2026
head ab8-eif2a labeling amount, ameliorated pmpcbhza22/hza22 chemical treatment by environment: 4-phenylbutyric acid Fig. 7 with image from Jing et al., 2026
eye Ab32-GFAP labeling decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 5 with image from Jing et al., 2026
glial cell gfap expression decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 2 with image from Jing et al., 2026
head Ab32-GFAP labeling decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 8 with image from Jing et al., 2026
brain ern1 expression amount, ameliorated pmpcbhza22/hza22 chemical treatment by environment: 4-phenylbutyric acid Fig. 7 with image from Jing et al., 2026
head Ab6-hspd1 labeling decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 3 with image,  Fig. 8 with image from Jing et al., 2026
head Ab27-casp3 labeling increased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 4 with image from Jing et al., 2026
central nervous system glial cell gfap expression amount, ameliorated pmpcbhza22/hza22 chemical treatment by environment: 4-phenylbutyric acid Fig. 7 with image from Jing et al., 2026
head cell division increased occurrence, abnormal pmpcbhza22/hza22 standard conditions Fig. 4 with image from Jing et al., 2026
spinal cord myelination decreased occurrence, abnormal pmpcbhza22/hza22 standard conditions Fig. 1 with image from Jing et al., 2026
central nervous system glial cell vim expression amount, ameliorated pmpcbhza22/hza22 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 6 with image from Jing et al., 2026
brain eif2ak3 expression amount, ameliorated pmpcbhza22/hza22 chemical treatment by environment: 4-phenylbutyric acid Fig. 7 with image from Jing et al., 2026
head Ab19-sox2 labeling decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 8 with image from Jing et al., 2026
reactive oxygen species biosynthetic process increased occurrence, abnormal pmpcbhza22/hza22 standard conditions Fig. 7 with image from Jing et al., 2026
head ab8-eif2a labeling increased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 7 with image from Jing et al., 2026
glial cell mbpa expression decreased amount, abnormal pmpcbhza22/hza22 standard conditions Fig. 2 with image from Jing et al., 2026
larval locomotory behavior decreased rate, abnormal pmpcbhza21/+ standard conditions Fig. 1 with image from Jing et al., 2026
neuronal stem cell sox2 expression decreased amount, abnormal pmpcbhza21/+ standard conditions Fig. 2 with image from Jing et al., 2026
glial cell gfap expression decreased amount, abnormal pmpcbhza21/+ standard conditions Fig. 2 with image from Jing et al., 2026
larval locomotory behavior decreased rate, abnormal pmpcbhza22/+ standard conditions Fig. 1 with image from Jing et al., 2026
central nervous system glial cell gfap expression decreased amount, abnormal pmpcbhza22/+ standard conditions Fig. 8 with image from Jing et al., 2026
neuronal stem cell sox2 expression decreased amount, abnormal pmpcbhza22/+ standard conditions Fig. 2 with image from Jing et al., 2026
glial cell gfap expression decreased amount, abnormal pmpcbhza22/+ standard conditions Fig. 2 with image from Jing et al., 2026
central nervous system glial cell vim expression amount, ameliorated pmpcbhza21/hza21 + MO4-tp53 standard conditions Fig. 4 with image from Jing et al., 2026
central nervous system glial cell vim expression amount, ameliorated pmpcbhza22/hza22 + MO4-tp53 standard conditions Fig. 4 with image from Jing et al., 2026
central nervous system glial cell axin2 expression amount, ameliorated pmpcbhza21/hza21; hza23Tg/hza23Tg standard conditions Fig. 8 with image from Jing et al., 2026
head Ab1-LIAS labeling amount, ameliorated pmpcbhza21/hza21; hza23Tg/hza23Tg standard conditions Fig. 8 with image from Jing et al., 2026
central nervous system glial cell vim expression amount, ameliorated pmpcbhza21/hza21; hza23Tg/hza23Tg standard conditions Fig. 8 with image from Jing et al., 2026
head ab8-ctnnb labeling amount, ameliorated pmpcbhza21/hza21; hza23Tg/hza23Tg standard conditions Fig. 8 with image from Jing et al., 2026
head Ab36-ctnnb labeling amount, ameliorated pmpcbhza21/hza21; hza23Tg/hza23Tg standard conditions Fig. 8 with image from Jing et al., 2026
head Ab32-GFAP labeling amount, ameliorated pmpcbhza21/hza21; hza23Tg/hza23Tg standard conditions Fig. 8 with image from Jing et al., 2026
head axin2 expression amount, ameliorated pmpcbhza21/hza21; hza23Tg/hza23Tg standard conditions Fig. 8 with image from Jing et al., 2026
head Ab6-hspd1 labeling amount, ameliorated pmpcbhza21/hza21; hza23Tg/hza23Tg standard conditions Fig. 8 with image from Jing et al., 2026
head Ab19-sox2 labeling amount, ameliorated pmpcbhza21/hza21; hza23Tg/hza23Tg standard conditions Fig. 8 with image from Jing et al., 2026
central nervous system glial cell gfap expression amount, ameliorated pmpcbhza21/hza21; hza23Tg/hza23Tg standard conditions Fig. 8 with image from Jing et al., 2026
head Ab6-hspd1 labeling amount, ameliorated pmpcbhza22/hza22; hza23Tg/hza23Tg standard conditions Fig. 8 with image from Jing et al., 2026
head Ab19-sox2 labeling amount, ameliorated pmpcbhza22/hza22; hza23Tg/hza23Tg standard conditions Fig. 8 with image from Jing et al., 2026
head Ab1-LIAS labeling amount, ameliorated pmpcbhza22/hza22; hza23Tg/hza23Tg standard conditions Fig. 8 with image from Jing et al., 2026
central nervous system glial cell gfap expression amount, ameliorated pmpcbhza22/hza22; hza23Tg/hza23Tg standard conditions Fig. 8 with image from Jing et al., 2026
central nervous system glial cell vim expression amount, ameliorated pmpcbhza22/hza22; hza23Tg/hza23Tg standard conditions Fig. 8 with image from Jing et al., 2026
head ab8-ctnnb labeling amount, ameliorated pmpcbhza22/hza22; hza23Tg/hza23Tg standard conditions Fig. 8 with image from Jing et al., 2026
head axin2 expression amount, ameliorated pmpcbhza22/hza22; hza23Tg/hza23Tg standard conditions Fig. 8 with image from Jing et al., 2026
head Ab36-ctnnb labeling amount, ameliorated pmpcbhza22/hza22; hza23Tg/hza23Tg standard conditions Fig. 8 with image from Jing et al., 2026
head Ab32-GFAP labeling amount, ameliorated pmpcbhza22/hza22; hza23Tg/hza23Tg standard conditions Fig. 8 with image from Jing et al., 2026
central nervous system glial cell axin2 expression amount, ameliorated pmpcbhza22/hza22; hza23Tg/hza23Tg standard conditions Fig. 8 with image from Jing et al., 2026
Citations