CRISPR

CRISPR1-sema4ab

ID
ZDB-CRISPR-260821-6
Name
CRISPR1-sema4ab
Previous Names
None
Target
Sequence
5' - ACCATGGTTACAGGACCCAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
tud123 sema4ab
Expression
Gene expression in Wild Types + CRISPR1-sema4ab
No data available
Phenotype
Phenotype resulting from CRISPR1-sema4ab
No data available
Phenotype of all Fish created by or utilizing CRISPR1-sema4ab
Phenotype Fish Conditions Figures
swimming behavior disrupted, abnormal sema4abtud123/tud123 (AB) transection: spinal cord Fig 6 with image from Docampo-Seara et al., 2026
swimming behavior decreased efficacy, abnormal sema4abtud123/tud123 (AB) transection: spinal cord Fig 6 with image from Docampo-Seara et al., 2026
spinal cord axon regeneration decreased occurrence, abnormal sema4abtud123/tud123 (AB) transection: spinal cord Fig 6 with image from Docampo-Seara et al., 2026
spinal cord tgfb1a expression decreased amount, abnormal AB + CRISPR1-sema4ab transection: spinal cord Fig 8 with image from Docampo-Seara et al., 2026
spinal cord il6 expression decreased amount, abnormal AB + CRISPR1-sema4ab transection: spinal cord Fig 8 with image from Docampo-Seara et al., 2026
spinal cord il1b expression decreased amount, abnormal AB + CRISPR1-sema4ab transection: spinal cord Fig 8 with image from Docampo-Seara et al., 2026
spinal cord saa expression decreased amount, abnormal AB + CRISPR1-sema4ab transection: spinal cord Fig 8 with image from Docampo-Seara et al., 2026
spinal cord tgfb3 expression increased amount, abnormal AB + CRISPR1-sema4ab transection: spinal cord Fig 8 with image from Docampo-Seara et al., 2026
spinal cord il11b expression decreased amount, abnormal AB + CRISPR1-sema4ab transection: spinal cord Fig 8 with image from Docampo-Seara et al., 2026
microglial cell decreased amount, abnormal gl23Tg + CRISPR1-sema4ab (AB) transection: spinal cord Fig 8 with image from Docampo-Seara et al., 2026
microglial cell cell population proliferation decreased occurrence, abnormal gl23Tg + CRISPR1-sema4ab (AB) transection: spinal cord Fig 8 with image from Docampo-Seara et al., 2026
spinal cord spinal cord motor neuron differentiation increased occurrence, abnormal ml2Tg + CRISPR1-sema4ab (AB) transection: spinal cord Fig 5 with image from Docampo-Seara et al., 2026
radial glial cell cell population proliferation increased occurrence, abnormal y83Tg + CRISPR1-sema4ab (AB) transection: spinal cord Fig 5 with image from Docampo-Seara et al., 2026
spinal cord neuroblast (sensu Vertebrata) increased amount, abnormal y83Tg + CRISPR1-sema4ab (AB) transection: spinal cord Fig 5 with image from Docampo-Seara et al., 2026
spinal cord spinal cord motor neuron differentiation increased occurrence, abnormal sema4abtud123/tud123; ml2Tg (AB) transection: spinal cord Fig 5 with image from Docampo-Seara et al., 2026
spinal cord spinal cord motor neuron differentiation normal occurrence, ameliorated ml2Tg + CRISPR1-sema4ab + CRISPR2-tgfb3 (AB) transection: spinal cord Fig 9 with image from Docampo-Seara et al., 2026
Citations