Fig. 2
- ID
- ZDB-IMAGE-231215-92
- Genes
- Publication
- Baker et al., 2022 - In Toto imaging of early enteric nervous system Development reveals that gut colonization is tied to proliferation downstream of ret
- All Figures
- Figures for Baker et al., 2022
Fig. 2 A novel CRISPR-Cas9 generated ret zebrafish mutant. (A) Schematic of receptor tyrosine kinase gene, ret and its resulting mRNA. (B) Diagram depicting injection of sgRNA and Cas9 mRNA into ret+/+ Tg(−8.3phox2bb:Kaede) and crosses used to isolate single CRISPR generate lesion within ret allele. (C) Zoomed in region of coding sequence of exon 8 (red arrow) targeted by sgRNA sequence (GAGACAGCGAGGAGACTGTG, yellow highlight) adjacent to PAM motif (red highlight). CRISPR-Cas9 activity at this locus generated an 11 bp deletion that resulted in nonsense mutation (stop codon, asterisk). (D-F) Representative images (left) and resulting genotypes (right) from in-crossing F1 heterozygotes harboring nonsense mutation (retwmr1/+), which produces phenotypic WT (ret+/+) (D), hypoganglionosis or HSCR-like (retwmr1/+) (E) and total aganglionosis (retwmr1/ wmr1) (F). Scale bars: 100 µm. A, anterior; D, dorsal; P, posterior; V, ventral.