Morpholino

MO1-notch3

ID

ZDB-MRPHLNO-041207-7

Name

MO1-notch3

Previous Names

MO-notch3-1 (1)

Target

notch3 (1)

Sequence

5' - ATATCCAAAGGCTGTAATTCCCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

designed to bind to 5'-end of gene

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-notch3

No data available

Phenotype

Phenotype resulting from MO1-notch3

No data available

Phenotype of all Fish created by or utilizing MO1-notch3

Phenotype	Fish	Conditions	Figures
rhombomere boundary formation disrupted, abnormal	notch1a^th35b/th35b + MO1-notch3	standard conditions	Fig. 5 from Qiu et al., 2009
neural tube morphology, abnormal	notch1a^th35b/th35b + MO1-notch3	standard conditions	Fig. 5 from Qiu et al., 2009
hindbrain neuroepithelial cell aggregated, abnormal	notch1a^th35b/th35b + MO1-notch3	standard conditions	Fig. 5 from Qiu et al., 2009
ectoderm development disrupted, abnormal	notch1a^th35b/th35b + MO1-notch3	standard conditions	Fig. 4 from Hsiao et al., 2007
hindbrain neuron increased amount, abnormal	notch1a^th35b/th35b + MO1-notch3	standard conditions	Fig. 5 from Qiu et al., 2009
hindbrain epithelium disorganized, abnormal	notch1a^th35b/th35b + MO1-notch3	standard conditions	Fig. 5 from Qiu et al., 2009
hindbrain development disrupted, abnormal	notch1a^th35b/th35b + MO1-notch3	standard conditions	Fig. 5 from Qiu et al., 2009
neural plate morphology, abnormal	WT + MO1-notch1a + MO1-notch3	standard conditions	Fig. 1 from Yeo et al., 2007
negative regulation of neurogenesis decreased occurrence, abnormal	WT + MO1-notch1a + MO1-notch3	standard conditions	Fig. 5 from Ishitani et al., 2010
central nervous system cellular quality, abnormal	WT + MO1-notch1a + MO1-notch3	standard conditions	Fig. 5 from Yeo et al., 2007
Notch signaling pathway decreased occurrence, abnormal	WT + MO1-notch1a + MO1-notch3	standard conditions	Fig. 5 from Ishitani et al., 2010
neurogenesis increased occurrence, abnormal	WT + MO1-notch1a + MO1-notch3	standard conditions	Fig. 5 from Ishitani et al., 2010
neural plate development process quality, abnormal	WT + MO1-notch1a + MO1-notch3	standard conditions	Fig. 1 from Yeo et al., 2007
negative regulation of neurogenesis decreased occurrence, abnormal	WT + MO1-nlk1 + MO1-notch1a + MO1-notch3	standard conditions	Fig. 5 from Ishitani et al., 2010
Notch signaling pathway decreased occurrence, abnormal	WT + MO1-nlk1 + MO1-notch1a + MO1-notch3	standard conditions	Fig. 5 from Ishitani et al., 2010
neurogenesis increased occurrence, abnormal	WT + MO1-nlk1 + MO1-notch1a + MO1-notch3	standard conditions	Fig. 5 from Ishitani et al., 2010
peripheral neuron decreased length, abnormal	knu2Tg + MO1-notch1a + MO1-notch3 + MO4-notch1b	standard conditions	Fig. 4 from So et al., 2009
dorsal aorta mural cell absent, abnormal	ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2	standard conditions	Fig. 3 from Ando et al., 2019
intersegmental vessel mural cell absent, abnormal	ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2	standard conditions	Fig. 3 from Ando et al., 2019
intersegmental vessel mural cell decreased amount, abnormal	ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2	standard conditions	Fig. 3 from Ando et al., 2019
intersegmental vessel mural cell decreased amount, exacerbated	ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2	chemical treatment by environment: DAPT	Fig. 3 from Ando et al., 2019
hyaloid vessel mural cell decreased amount, abnormal	ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2	standard conditions	Fig. 3 from Ando et al., 2019
brain vasculature mural cell absent, abnormal	ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2	standard conditions	Fig. 3 from Ando et al., 2019
brain vasculature pericyte decreased amount, abnormal	ncv1Tg; ncv34Tg; nkuasgfp1aTg + MO1-notch3 + MO2-notch2	standard conditions	Fig. 3 from Ando et al., 2019
brain vasculature pericyte absent, abnormal	ncv1Tg; ncv34Tg; nkuasgfp1aTg + MO1-notch3 + MO2-notch2	standard conditions	Fig. 3 from Ando et al., 2019
dorsal aorta vascular associated smooth muscle cell decreased amount, abnormal	s843Tg; uto5Tg + MO1-notch3 + MO2-notch1b	control	Fig. 3 from Chen et al., 2017
dorsal aorta anatomical region mCherry expression absent, abnormal	s843Tg; uto5Tg + MO1-notch3 + MO2-notch1b	control	Fig. 3 from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell mCherry expression absent, abnormal	s843Tg; uto5Tg + MO1-notch3 + MO2-notch1b	control	Fig. 3 from Chen et al., 2017

Citations