Morpholino

MO1-nkx6-1

ID
ZDB-MRPHLNO-050201-3
Name
MO1-nkx6-1
Previous Names
  • MO1-nkx6.1
  • nkx6.1-MO (1)
Target
Sequence
5' - CGCAAGAAGAAGGACAGTGACCCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Blocks translation.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nkx6-1
No data available
Phenotype
Phenotype resulting from MO1-nkx6-1
Phenotype of all Fish created by or utilizing MO1-nkx6-1
Phenotype Fish Conditions Figures
primary motor neuron axon decreased amount, abnormal AB + MO1-nkx6-1 standard conditions Fig. 3 with image from Hutchinson et al., 2007
primary motor neuron axon branched, abnormal AB + MO1-nkx6-1 standard conditions Fig. 3 with image from Hutchinson et al., 2007
neuron fate commitment disrupted, abnormal AB + MO1-nkx6-1 standard conditions Fig. 8 with image from Cheesman et al., 2004
primary motor neuron axon decreased length, abnormal AB + MO1-nkx6-1 standard conditions Fig. 3 with image from Hutchinson et al., 2007
VeLD increased amount, abnormal AB + MO1-nkx6-1 standard conditions Fig. 8 with image from Cheesman et al., 2004
secondary motor neuron decreased amount, abnormal AB + MO1-nkx6-1 standard conditions Fig. 8 with image from Cheesman et al., 2004
pancreatic bud has fewer parts of type pancreatic A cell, abnormal AB + MO1-nkx6-1 + MO2-nkx6-1 standard conditions Fig. 4 with image from Binot et al., 2010
pancreas primordium has fewer parts of type endocrine cell, abnormal AB + MO1-nkx6-1 + MO2-nkx6-1 standard conditions Fig. 7 with image,  Fig. 8 with image from Binot et al., 2010
pancreatic bud has fewer parts of type endocrine cell, abnormal AB + MO1-nkx6-1 + MO2-nkx6-1 standard conditions Fig. 7 with image from Binot et al., 2010
primary motor neuron axon decreased length, abnormal AB + MO1-nkx6-1 + MO1-nkx6-2 standard conditions Fig. 3 with image,  Fig. 4 with image from Hutchinson et al., 2007
primary motor neuron axon decreased amount, abnormal AB + MO1-nkx6-1 + MO1-nkx6-2 standard conditions Fig. 3 with image from Hutchinson et al., 2007
primary motor neuron axon branched, abnormal AB + MO1-nkx6-1 + MO1-nkx6-2 standard conditions Fig. 3 with image,  Fig. 4 with image from Hutchinson et al., 2007
primary motor neuron axon structure, abnormal AB + MO1-nkx6-1 + MO1-nkx6-2 standard conditions Fig. 4 with image from Hutchinson et al., 2007
Citations