Morpholino

MO2-neurog1

ID
ZDB-MRPHLNO-050202-2
Name
MO2-neurog1
Previous Names
  • ngn-MO (1)
Target
Sequence
5' - CCATATCGGAGTATACGATCTCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-neurog1
No data available
Phenotype
Phenotype resulting from MO2-neurog1
Phenotype of all Fish created by or utilizing MO2-neurog1
Phenotype Fish Conditions Figures
posterior lateral line neuromast hair cell amount, ameliorated TU + MO2-neurog1 chemical treatment by environment: kainic acid, chemical treatment by environment: 6-Cyano-7-nitroquinoxaline-2,3-dione Fig. 4 from Sheets, 2017
posterior lateral line neuromast neuromast hair cell ab5-casp3 labeling increased amount, abnormal TU + MO2-neurog1 chemical treatment by environment: kainic acid Fig. 7 with image from Sheets, 2017
posterior lateral line neuromast hair cell decreased amount, abnormal TU + MO2-neurog1 chemical treatment by environment: kainic acid Fig. 3 with image,  Fig. 4 from Sheets, 2017
afferent neuron neuron projection terminus decreased amount, abnormal TU + MO2-neurog1 control Fig. 2 with image from Sheets, 2017
posterior lateral line neuromast hair cell decreased amount, abnormal TU + MO2-neurog1 chemical treatment by environment: N-methyl-D-aspartic acid Fig. 3 with image,  Fig. 4 from Sheets, 2017
posterior lateral line neuromast hair cell decreased amount, exacerbated TU + MO2-neurog1 chemical treatment by environment: N-methyl-D-aspartic acid, chemical treatment by environment: kainic acid Fig. 4 from Sheets, 2017
neuromast hair cell apoptotic body increased amount, abnormal TU + MO2-neurog1 chemical treatment by environment: kainic acid Fig. 7 with image from Sheets, 2017
neuromast hair cell apoptotic process increased occurrence, abnormal TU + MO2-neurog1 chemical treatment by environment: kainic acid Fig. 7 with image from Sheets, 2017
posterior lateral line neuromast hair cell decreased amount, ameliorated TU + MO2-neurog1 chemical treatment by environment: N-methyl-D-aspartic acid, chemical treatment by environment: 2-amino-5-phosphonopentanoic acid Fig. 4 from Sheets, 2017
neuromast hair cell apoptotic body increased amount, abnormal TU + MO2-neurog1 chemical treatment by environment: N-methyl-D-aspartic acid Fig. 7 with image from Sheets, 2017
posterior lateral line neuromast neuromast hair cell ab5-casp3 labeling increased amount, abnormal TU + MO2-neurog1 chemical treatment by environment: N-methyl-D-aspartic acid Fig. 7 with image from Sheets, 2017
neuromast hair cell apoptotic process increased occurrence, exacerbated TU + MO2-neurog1 chemical treatment by environment: N-methyl-D-aspartic acid, chemical treatment by environment: kainic acid Fig. 7 with image from Sheets, 2017
posterior lateral line neuromast innervation decreased occurrence, abnormal TU + MO2-neurog1 control Fig. 2 with image from Sheets, 2017
neuromast hair cell apoptotic process increased occurrence, abnormal TU + MO2-neurog1 chemical treatment by environment: N-methyl-D-aspartic acid Fig. 7 with image from Sheets, 2017
dorsal root ganglion morphology, abnormal w61Tg + MO2-neurog1 standard conditions Fig. 6 from McGraw et al., 2008
hair cell GCaMP expression decreased amount, abnormal w78Tg + MO2-neurog1 chemical treatment by environment: N-methyl-D-aspartic acid, chemical treatment by environment: Isradipine Fig. 6 with image from Sheets, 2017
hair cell cytosol GCaMP expression increased amount, abnormal w78Tg + MO2-neurog1 chemical treatment by environment: gentamycin Fig. 6 with image from Sheets, 2017
Citations