Morpholino

MO1-olig2

ID

ZDB-MRPHLNO-050204-2

Name

MO1-olig2

Previous Names

Target

Sequence

5' - CGTTCAGTGCGCTCTCAGCTTCTCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

A translation blocking morpholino against olig2

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-olig2

No data available

Phenotype

Phenotype resulting from MO1-olig2

Phenotype	Fish	Figures
dopaminergic neuron decreased amount, abnormal	WT + MO1-olig2	Fig. 5 from Borodovsky et al., 2009
motor neuron lacks parts or has fewer parts of type motor neuron axon, abnormal	y1Tg/+ + MO1-olig2	Fig. 7 from Lim et al., 2011
oligodendrocyte development disrupted, abnormal	WT + MO1-olig2	Fig. 8 from Schebesta et al., 2009 Fig. 6 from Park et al., 2002
parachordal vessel immature, abnormal	y1Tg/+ + MO1-olig2	Fig. 7 from Lim et al., 2011
parachordal vessel venous endothelial cell migration involved in lymph vessel development arrested, abnormal	y1Tg/+ + MO1-olig2	Fig. 7 from Lim et al., 2011
spinal cord lacks all parts of type primary motor neuron, abnormal	WT + MO1-olig2	Fig. 5 from Park et al., 2002
spinal cord lacks parts or has fewer parts of type oligodendrocyte, abnormal	WT + MO1-olig2	Fig. 6 from Park et al., 2002
spinal cord motor neuron differentiation disrupted, abnormal	WT + MO1-olig2	Fig. 5 from Park et al., 2002

Phenotype of all Fish created by or utilizing MO1-olig2

Phenotype	Fish	Conditions	Figures
spinal cord motor neuron differentiation disrupted, abnormal	WT + MO1-olig2	standard conditions	Fig. 5 from Park et al., 2002
spinal cord lacks parts or has fewer parts of type oligodendrocyte, abnormal	WT + MO1-olig2	standard conditions	Fig. 6 from Park et al., 2002
spinal cord lacks all parts of type primary motor neuron, abnormal	WT + MO1-olig2	standard conditions	Fig. 5 from Park et al., 2002
dopaminergic neuron decreased amount, abnormal	WT + MO1-olig2	standard conditions	Fig. 5 from Borodovsky et al., 2009
oligodendrocyte development disrupted, abnormal	WT + MO1-olig2	standard conditions	Fig. 8 from Schebesta et al., 2009 Fig. 6 from Park et al., 2002
motor neuron lacks parts or has fewer parts of type motor neuron axon, abnormal	y1Tg/+ + MO1-olig2	standard conditions	Fig. 7 from Lim et al., 2011
parachordal vessel immature, abnormal	y1Tg/+ + MO1-olig2	standard conditions	Fig. 7 from Lim et al., 2011
parachordal vessel venous endothelial cell migration involved in lymph vessel development arrested, abnormal	y1Tg/+ + MO1-olig2	standard conditions	Fig. 7 from Lim et al., 2011
oligodendrocyte development disrupted, abnormal	WT + MO1-olig1 + MO1-olig2	standard conditions	Fig. 8 from Schebesta et al., 2009

Citations