Morpholino

MO2-gli2a

ID
ZDB-MRPHLNO-050308-4
Name
MO2-gli2a
Previous Names
  • gli2 MO (1)
  • MO2-gli2 (1)
Target
Sequence
5' - GAGGTGGGACTTGTGGTCTCCATGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino that targets gli2a.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-gli2a
No data available
Phenotype
Phenotype resulting from MO2-gli2a
Phenotype of all Fish created by or utilizing MO2-gli2a
Phenotype Fish Conditions Figures
muscle pioneer mislocalised, abnormal gli2aty119/ty119 + MO2-gli2a standard conditions Fig. 5 from Wolff et al., 2003
myotome malformed, abnormal WT + MO2-gli2a standard conditions Fig. 4 with image from Lobbardi et al., 2011
slow muscle cell mislocalised, abnormal WT + MO2-gli2a standard conditions Fig. 4 with image from Lobbardi et al., 2011
adaxial cell physical object quality, abnormal WT + MO2-gli2a standard conditions Fig. 4 with image from Lobbardi et al., 2011
skeletal muscle tissue development process quality, abnormal WT + MO2-gli2a standard conditions Fig. 4 with image from Lobbardi et al., 2011
somite U-shaped, abnormal WT + MO2-gli2a standard conditions Fig. 5 from Wolff et al., 2003
smoothened signaling pathway process quality, abnormal WT + MO2-gli2a standard conditions Fig. 4 with image from Lobbardi et al., 2011
horizontal myoseptum morphology, abnormal WT + MO2-gli2a standard conditions Fig. S1 with image from Ke et al., 2008
muscle pioneer mislocalised, abnormal WT + MO2-gli2a standard conditions Fig. 5 from Wolff et al., 2003
fast muscle cell increased amount, abnormal WT + MO2-gli2a standard conditions Fig. 5 from Wolff et al., 2003
slow muscle cell decreased amount, abnormal gli1ts269/ts269 + MO2-gli2a standard conditions Fig. 5 from Wolff et al., 2003
fast muscle cell absent, abnormal gli1ts269/ts269 + MO2-gli2a standard conditions Fig. 5 from Wolff et al., 2003
muscle pioneer absent, abnormal gli1ts269/ts269 + MO2-gli2a standard conditions Fig. 5 from Wolff et al., 2003
fast muscle cell increased amount, abnormal WT + MO1-stk36 + MO2-gli2a standard conditions Fig. 6 from Wolff et al., 2003
muscle pioneer absent, abnormal WT + MO1-stk36 + MO2-gli2a standard conditions Fig. 6 from Wolff et al., 2003
muscle pioneer mislocalised, abnormal WT + MO1-sufu + MO2-gli2a standard conditions Fig. 7 from Wolff et al., 2003
fast muscle cell increased amount, abnormal WT + MO1-sufu + MO2-gli2a standard conditions Fig. 7 from Wolff et al., 2003
Citations