Morpholino

MO3-cdh1

ID
ZDB-MRPHLNO-050421-1
Name
MO3-cdh1
Previous Names
  • e-cad-MO (1)
  • e-cadMO (1)
  • e-cadherin morpholino (1)
  • e-cadherin-MO (1)
  • mphEcadst-25 (1)
Target
Sequence
5' - ATCCCACAGTTGTTACACAAGCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-cdh1
No data available
Phenotype
Phenotype resulting from MO3-cdh1
Phenotype of all Fish created by or utilizing MO3-cdh1
Phenotype Fish Conditions Figures
cell migration involved in gastrulation decreased rate, abnormal WT + MO3-cdh1 standard conditions Fig. 4 with imageFig. 5 with image from Arboleda-Estudillo et al., 2010
homotypic cell-cell adhesion arrested, abnormal WT + MO3-cdh1 standard conditions Fig. 1 from Krieg et al., 2008
cell migration involved in gastrulation process quality, abnormal WT + MO3-cdh1 standard conditions Fig. 4 with image from Schepis et al., 2012
cell-cell adhesion involved in mesendodermal cell migration disrupted, abnormal WT + MO3-cdh1 standard conditions Fig. 4 with image from Arboleda-Estudillo et al., 2010
lateral mesoderm mesodermal cell decreased speed, abnormal WT + MO3-cdh1 standard conditions Fig. 4 with imageFig. 5 with image from Arboleda-Estudillo et al., 2010
DEL ctnna1 expression mislocalised, abnormal WT + MO3-cdh1 standard conditions Fig. 2 with image from Schepis et al., 2012
protein localization to plasma membrane disrupted, abnormal WT + MO3-cdh1 standard conditions Fig. 2 with image from Schepis et al., 2012
Muller cell cell population proliferation decreased occurrence, abnormal WT + MO3-cdh1 perforation: retina Figure 4. with image from Sharma et al., 2019
lateral mesoderm mesodermal cell misrouted, abnormal WT + MO3-cdh1 standard conditions Fig. 4 with imageFig. 5 with image from Arboleda-Estudillo et al., 2010
polster decreased length, abnormal WT + MO3-cdh1 + MO4-cdh1 standard conditions Fig. 3 with image from Blanco et al., 2007
polster morphology, abnormal WT + MO3-cdh1 + MO4-cdh1 standard conditions Fig. 3 with image from Blanco et al., 2007
epiboly involved in gastrulation with mouth forming second disrupted, abnormal epcamhi2151Tg/hi2151Tg + MO3-cdh1 standard conditions Fig. 10 with image from Slanchev et al., 2009
cell-cell adhesion involved in gastrulation disrupted, abnormal epcamhi2151Tg/hi2151Tg + MO3-cdh1 standard conditions Fig. 9 with image from Slanchev et al., 2009
whole organism broken, abnormal epcamhi2151Tg/hi2151Tg + MO3-cdh1 standard conditions Fig. 9 with image from Slanchev et al., 2009
hatching gland ctslb expression spatial pattern, abnormal TL + MO1-spint2 + MO3-cdh1 standard conditions Fig. 9 with image from Hatzold et al., 2021
hatching gland cell division increased frequency, abnormal TL + MO1-spint2 + MO3-cdh1 standard conditions Fig. 9 with image from Hatzold et al., 2021
hatching gland hatching gland cell irregular spatial pattern, abnormal TL + MO1-spint2 + MO3-cdh1 standard conditions Fig. 9 with image from Hatzold et al., 2021
DEL plasma membrane physical quality, ameliorated WT + MO1-ctnna1 + MO3-cdh1 standard conditions Fig. 8 with image from Schepis et al., 2012
EVL morphology, abnormal WT + MO1-ctnna1 + MO3-cdh1 standard conditions Fig. 3 with image from Schepis et al., 2012
DEL plasma membrane physical quality, ameliorated WT + MO1-ezrb + MO3-cdh1 standard conditions Fig. 9 with image from Schepis et al., 2012
Muller cell cell population proliferation decreased occurrence, exacerbated WT + MO3-cdh1 + MO3-pou5f3 perforation: retina Figure 4. with image from Sharma et al., 2019
Citations