Morpholino

MO3-ift88

ID

ZDB-MRPHLNO-050513-1

Name

MO3-ift88

Previous Names

ift88ATG (1)
MO3-ttc10 (1)

Target

ift88 (1)

Sequence

5' - GCCTTATTAAACAGAAATACTCCCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Targeted to 5' UTR of ift88 (ttc10). This morpholino was used in studies reported in ZDB-PUB-080527-11 but was cited with a typo in the Materials and Methods that left off the first three nucleotides (GCC).

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-ift88

No data available

Phenotype

Phenotype resulting from MO3-ift88

Phenotype	Fish	Figures
cilium assembly disrupted, abnormal	WT + MO3-ift88	Fig. 2 from Lunt et al., 2009
eye decreased size, abnormal	WT + MO3-ift88	Fig. S1 from Krock et al., 2008
neural tube axoneme absent, abnormal	WT + MO3-ift88	Fig. 2 from Lunt et al., 2009
otic vesicle decreased size, abnormal	WT + MO3-ift88	Fig. 2 from Lunt et al., 2009
otic vesicle cilium decreased amount, abnormal	WT + MO3-ift88	Fig. 2 from Lunt et al., 2009
otic vesicle cilium decreased length, abnormal	WT + MO3-ift88	Fig. 2 from Lunt et al., 2009
post-vent region curved ventral, abnormal	WT + MO3-ift88	Fig. S1 from Krock et al., 2008
pronephros cystic, abnormal	WT + MO3-ift88	Fig. S1 from Krock et al., 2008
retina photoreceptor outer segment absent, abnormal	WT + MO3-ift88	Fig. 1 from Krock et al., 2008
retinal outer nuclear layer perforate, abnormal	WT + MO3-ift88	Fig. 1 from Krock et al., 2008
retinal outer nuclear layer eye photoreceptor cell apoptotic, abnormal	WT + MO3-ift88	Fig. 1 from Krock et al., 2008

Phenotype of all Fish created by or utilizing MO3-ift88

Phenotype	Fish	Conditions	Figures
otic vesicle cilium decreased amount, abnormal	WT + MO3-ift88	standard conditions	Fig. 2 from Lunt et al., 2009
retinal outer nuclear layer eye photoreceptor cell apoptotic, abnormal	WT + MO3-ift88	standard conditions	Fig. 1 from Krock et al., 2008
otic vesicle decreased size, abnormal	WT + MO3-ift88	standard conditions	Fig. 2 from Lunt et al., 2009
retinal outer nuclear layer perforate, abnormal	WT + MO3-ift88	standard conditions	Fig. 1 from Krock et al., 2008
pronephros cystic, abnormal	WT + MO3-ift88	standard conditions	Fig. S1 from Krock et al., 2008
eye decreased size, abnormal	WT + MO3-ift88	standard conditions	Fig. S1 from Krock et al., 2008
otic vesicle cilium decreased length, abnormal	WT + MO3-ift88	standard conditions	Fig. 2 from Lunt et al., 2009
retina photoreceptor outer segment absent, abnormal	WT + MO3-ift88	standard conditions	Fig. 1 from Krock et al., 2008
cilium assembly disrupted, abnormal	WT + MO3-ift88	standard conditions	Fig. 2 from Lunt et al., 2009
neural tube axoneme absent, abnormal	WT + MO3-ift88	standard conditions	Fig. 2 from Lunt et al., 2009
post-vent region curved ventral, abnormal	WT + MO3-ift88	standard conditions	Fig. S1 from Krock et al., 2008
heart notch1b expression decreased amount, abnormal	twu26Tg + MO1-ift88 + MO3-ift88	control	Fig. 6 from Samsa et al., 2015
heart nrg1 expression decreased amount, abnormal	twu26Tg + MO1-ift88 + MO3-ift88	control	Fig. 6 from Samsa et al., 2015
trabecular layer absent, abnormal	s940Tg; vc6Tg + MO1-ift88 + MO3-ift88	control	Fig. 6 from Samsa et al., 2015
cardiac ventricle Venus expression decreased amount, abnormal	s940Tg; vc6Tg + MO1-ift88 + MO3-ift88	control	Fig. 6 from Samsa et al., 2015
atrioventricular canal endocardium Venus expression decreased amount, abnormal	s940Tg; vc6Tg + MO1-ift88 + MO3-ift88	control	Fig. 6 from Samsa et al., 2015

Citations