Morpholino

MO1-efnb2a

ID
ZDB-MRPHLNO-050523-1
Name
MO1-efnb2a
Previous Names
None
Target
Sequence
5' - CGGTCAAATTCCGTTTCGCGGGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-efnb2a
No data available
Phenotype
Phenotype resulting from MO1-efnb2a
Phenotype of all Fish created by or utilizing MO1-efnb2a
Phenotype Fish Conditions Figures
dorsal aorta aplastic, abnormal WT + MO1-efnb2a standard conditions Fig. 4 from Herbert et al., 2009
blood vessel morphogenesis disrupted, abnormal WT + MO1-efnb2a standard conditions Fig. 4 from Herbert et al., 2009
optic vesicle morphogenesis disrupted, abnormal WT + MO1-efnb1 + MO1-efnb2a standard conditions Fig. 2 with image from Cavodeassi et al., 2013
trigeminal motor nucleus fused with trigeminal motor nucleus, abnormal WT + MO1-efnb2a + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
rhombomere 5 rhombomere boundary formation process quality, abnormal WT + MO1-efnb2a + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
rhombomere 3 rhombomere boundary formation process quality, abnormal WT + MO1-efnb2a + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
abducens motor nucleus fused with abducens motor nucleus, abnormal WT + MO1-efnb2a + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
rhombomere boundary formation process quality, abnormal WT + MO1-efnb2a + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
optic vesicle morphogenesis disrupted, abnormal WT + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 2 with image from Cavodeassi et al., 2013
eye field cell fate commitment involved in camera-type eye formation disrupted, abnormal b1200Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
immature eye cell migration disrupted, abnormal b1200Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
optic vesicle morphogenesis disrupted, abnormal b1200Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
telencephalon cell migration disrupted, abnormal b1200Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
eye field cell fate commitment involved in camera-type eye formation disrupted, abnormal zf460Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
optic vesicle morphogenesis disrupted, abnormal zf460Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
immature eye cell migration disrupted, abnormal zf460Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
telencephalon cell migration disrupted, abnormal zf460Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
Citations