Morpholino

MO1-hsp70.3

ID
ZDB-MRPHLNO-050726-2
Name
MO1-hsp70.3
Previous Names
  • hsp70-MO2 (1)
Targets
Sequence
5' - ATGATTGATTTCAAGAAACTGCAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hsp70.3
No data available
Phenotype
Phenotype resulting from MO1-hsp70.3
No data available
Phenotype of all Fish created by or utilizing MO1-hsp70.3
Phenotype Fish Conditions Figures
whole organism ventral region szl expression decreased amount, abnormal AB + MO1-hsp70.3 standard conditions Fig 8 with image from Ye et al., 2019
whole organism ventral region ved expression decreased amount, abnormal AB + MO1-hsp70.3 standard conditions Fig 8 with image from Ye et al., 2019
whole organism ventral region szl expression decreased distribution, abnormal AB + MO1-hsp70.3 standard conditions Fig 8 with image from Ye et al., 2019
whole organism ventral region ved expression decreased distribution, abnormal AB + MO1-hsp70.3 standard conditions Fig 8 with image from Ye et al., 2019
non neural ectoderm foxi1 expression decreased distribution, abnormal AB + MO1-hsp70.3 standard conditions Fig 8 with image from Ye et al., 2019
neuroectoderm otx2b expression increased distribution, abnormal AB + MO1-hsp70.3 standard conditions Fig 8 with image from Ye et al., 2019
non neural ectoderm foxi1 expression decreased amount, abnormal AB + MO1-hsp70.3 standard conditions Fig 8 with image from Ye et al., 2019
neuroectoderm otx2b expression increased amount, abnormal AB + MO1-hsp70.3 standard conditions Fig 8 with image from Ye et al., 2019
whole organism ventral region szl expression decreased amount, abnormal marcksbihb199/ihb199 + MO1-hsp70.3 standard conditions Fig 7 with image from Ye et al., 2019
whole organism ventral region szl expression decreased distribution, abnormal marcksbihb199/ihb199 + MO1-hsp70.3 standard conditions Fig 7 with image from Ye et al., 2019
whole organism ventral region szl expression decreased amount, abnormal AB + MO1-hsp70.3 + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
whole organism ventral region ved expression decreased amount, abnormal AB + MO1-hsp70.3 + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
whole organism spindle-shaped, abnormal AB + MO1-hsp70.3 + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
whole organism ventral region szl expression decreased distribution, abnormal AB + MO1-hsp70.3 + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
non neural ectoderm foxi1 expression decreased amount, abnormal AB + MO1-hsp70.3 + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
neuroectoderm otx2b expression increased amount, abnormal AB + MO1-hsp70.3 + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
whole organism ventral region ved expression decreased distribution, abnormal AB + MO1-hsp70.3 + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
non neural ectoderm foxi1 expression decreased distribution, abnormal AB + MO1-hsp70.3 + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
neuroectoderm otx2b expression increased distribution, abnormal AB + MO1-hsp70.3 + MO1-marcksb standard conditions Fig 8 with image from Ye et al., 2019
Citations