Morpholino

MO2-cdh4

ID
ZDB-MRPHLNO-050930-3
Name
MO2-cdh4
Previous Names
  • RcadMphB (1)
Target
Sequence
5' - TTCCTGTGAGATGTGCTGTCGGTAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cdh4
No data available
Phenotype
Phenotype resulting from MO2-cdh4
Phenotype Fish Figures
amacrine cell differentiation disrupted, abnormal WT + MO2-cdh4 Fig. 5 with image from Babb et al., 2005
apoptotic process increased occurrence, abnormal WT + MO2-cdh4 Fig. 7 with image from Babb et al., 2005
brain disorganized, abnormal WT + MO2-cdh4 Fig. 1 with image from Babb et al., 2005
cranial nerve II decreased thickness, abnormal WT + MO2-cdh4 Fig. 5 with image from Babb et al., 2005
cranial nerve II fasciculation, abnormal WT + MO2-cdh4 Fig. 4 with image from Babb et al., 2005
cranial nerve II sparse, abnormal WT + MO2-cdh4 Fig. 4 with image,  Fig. 9 with image from Babb et al., 2005
cranial nerve II truncated, abnormal WT + MO2-cdh4 Fig. 9 with image from Babb et al., 2005
eye decreased size, abnormal WT + MO2-cdh4 Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image from Babb et al., 2005
fourth ventricle increased size, abnormal WT + MO2-cdh4 Fig. 1 with image from Babb et al., 2005
hindbrain decreased size, abnormal WT + MO2-cdh4 Fig. 1 with image from Babb et al., 2005
lens apoptotic, abnormal WT + MO2-cdh4 Fig. 7 with image from Babb et al., 2005
lens decreased size, abnormal WT + MO2-cdh4 Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image from Babb et al., 2005
optic nerve development disrupted, abnormal WT + MO2-cdh4 Fig. 4 with image from Babb et al., 2005
optic tectum morphology, abnormal WT + MO2-cdh4 Fig. 8 with image,  Fig. 9 with image from Babb et al., 2005
photoreceptor cell differentiation disrupted, abnormal WT + MO2-cdh4 Fig. 5 with image,  Fig. 6 with image from Babb et al., 2005
retina apoptotic, abnormal WT + MO2-cdh4 Fig. 7 with image from Babb et al., 2005
retina hypoplastic, abnormal WT + MO2-cdh4 Fig. 2 with image from Babb et al., 2005
retina lacks parts or has fewer parts of type amacrine cell, abnormal WT + MO2-cdh4 Fig. 5 with image from Babb et al., 2005
retina lacks parts or has fewer parts of type photoreceptor cell, abnormal WT + MO2-cdh4 Fig. 5 with image from Babb et al., 2005
retina development in camera-type eye disrupted, abnormal WT + MO2-cdh4 Fig. 5 with image from Babb et al., 2005
retina layer formation disrupted, abnormal WT + MO2-cdh4 Fig. 1 with image,  Fig. 2 with image,  Fig. 6 with image from Babb et al., 2005
retinal ganglion cell decreased amount, abnormal WT + MO2-cdh4 Fig. 5 with image from Babb et al., 2005
retinal ganglion cell lacks parts or has fewer parts of type retinal ganglion cell neuron projection, abnormal WT + MO2-cdh4 Fig. 4 with image from Babb et al., 2005
retinal ganglion cell neuron projection physical object quality, abnormal WT + MO2-cdh4 Fig. 8 with image,  Fig. 9 with image from Babb et al., 2005
retinal ganglion cell axon guidance disrupted, abnormal WT + MO2-cdh4 Fig. 4 with image,  Fig. 9 with image from Babb et al., 2005
retinal ganglion cell layer decreased thickness, abnormal WT + MO2-cdh4 Fig. 5 with image from Babb et al., 2005
retinal ganglion cell layer disorganized, abnormal WT + MO2-cdh4 Fig. 4 with image from Babb et al., 2005
retinal ganglion cell layer sparse, abnormal WT + MO2-cdh4 Fig. 4 with image,  Fig. 5 with image from Babb et al., 2005
retinal ganglion cell layer compartment boundary rough, abnormal WT + MO2-cdh4 Fig. 5 with image from Babb et al., 2005
whole organism decreased length, abnormal WT + MO2-cdh4 Fig. 1 with image from Babb et al., 2005
Phenotype of all Fish created by or utilizing MO2-cdh4
Phenotype Fish Conditions Figures
lens decreased size, abnormal WT + MO2-cdh4 standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image from Babb et al., 2005
eye decreased size, abnormal WT + MO2-cdh4 standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image from Babb et al., 2005
retinal ganglion cell layer sparse, abnormal WT + MO2-cdh4 standard conditions Fig. 4 with image,  Fig. 5 with image from Babb et al., 2005
apoptotic process increased occurrence, abnormal WT + MO2-cdh4 standard conditions Fig. 7 with image from Babb et al., 2005
retinal ganglion cell lacks parts or has fewer parts of type retinal ganglion cell neuron projection, abnormal WT + MO2-cdh4 standard conditions Fig. 4 with image from Babb et al., 2005
optic tectum morphology, abnormal WT + MO2-cdh4 standard conditions Fig. 8 with image,  Fig. 9 with image from Babb et al., 2005
retina lacks parts or has fewer parts of type photoreceptor cell, abnormal WT + MO2-cdh4 standard conditions Fig. 5 with image from Babb et al., 2005
retinal ganglion cell layer compartment boundary rough, abnormal WT + MO2-cdh4 standard conditions Fig. 5 with image from Babb et al., 2005
cranial nerve II fasciculation, abnormal WT + MO2-cdh4 standard conditions Fig. 4 with image from Babb et al., 2005
retinal ganglion cell neuron projection physical object quality, abnormal WT + MO2-cdh4 standard conditions Fig. 8 with image,  Fig. 9 with image from Babb et al., 2005
retina hypoplastic, abnormal WT + MO2-cdh4 standard conditions Fig. 2 with image from Babb et al., 2005
photoreceptor cell differentiation disrupted, abnormal WT + MO2-cdh4 standard conditions Fig. 5 with image,  Fig. 6 with image from Babb et al., 2005
hindbrain decreased size, abnormal WT + MO2-cdh4 standard conditions Fig. 1 with image from Babb et al., 2005
cranial nerve II decreased thickness, abnormal WT + MO2-cdh4 standard conditions Fig. 5 with image from Babb et al., 2005
retinal ganglion cell decreased amount, abnormal WT + MO2-cdh4 standard conditions Fig. 5 with image from Babb et al., 2005
cranial nerve II truncated, abnormal WT + MO2-cdh4 standard conditions Fig. 9 with image from Babb et al., 2005
retinal ganglion cell axon guidance disrupted, abnormal WT + MO2-cdh4 standard conditions Fig. 4 with image,  Fig. 9 with image from Babb et al., 2005
brain disorganized, abnormal WT + MO2-cdh4 standard conditions Fig. 1 with image from Babb et al., 2005
lens apoptotic, abnormal WT + MO2-cdh4 standard conditions Fig. 7 with image from Babb et al., 2005
retinal ganglion cell layer disorganized, abnormal WT + MO2-cdh4 standard conditions Fig. 4 with image from Babb et al., 2005
optic nerve development disrupted, abnormal WT + MO2-cdh4 standard conditions Fig. 4 with image from Babb et al., 2005
fourth ventricle increased size, abnormal WT + MO2-cdh4 standard conditions Fig. 1 with image from Babb et al., 2005
whole organism decreased length, abnormal WT + MO2-cdh4 standard conditions Fig. 1 with image from Babb et al., 2005
retina lacks parts or has fewer parts of type amacrine cell, abnormal WT + MO2-cdh4 standard conditions Fig. 5 with image from Babb et al., 2005
retina layer formation disrupted, abnormal WT + MO2-cdh4 standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. 6 with image from Babb et al., 2005
retina development in camera-type eye disrupted, abnormal WT + MO2-cdh4 standard conditions Fig. 5 with image from Babb et al., 2005
retinal ganglion cell layer decreased thickness, abnormal WT + MO2-cdh4 standard conditions Fig. 5 with image from Babb et al., 2005
cranial nerve II sparse, abnormal WT + MO2-cdh4 standard conditions Fig. 4 with image,  Fig. 9 with image from Babb et al., 2005
amacrine cell differentiation disrupted, abnormal WT + MO2-cdh4 standard conditions Fig. 5 with image from Babb et al., 2005
retina apoptotic, abnormal WT + MO2-cdh4 standard conditions Fig. 7 with image from Babb et al., 2005
Citations