Morpholino

MO1-mib1

ID
ZDB-MRPHLNO-051121-1
Name
MO1-mib1
Previous Names
  • ex/int1 (1)
Target
Sequence
5' - GCAGCCTCACCTGTAGGCGCACTGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mib1
No data available
Phenotype
Phenotype resulting from MO1-mib1
Phenotype of all Fish created by or utilizing MO1-mib1
Phenotype Fish Conditions Figures
spinal cord generation of neurons process quality, abnormal AB + MO1-mib1 standard conditions Fig. 4 from Kressmann et al., 2015
notochord increased width, abnormal AB/TU + MO1-mib1 standard conditions Figure 1 with image from Saraswathy et al., 2022
neural plate increased width, abnormal AB/TU + MO1-mib1 standard conditions Figure 1 with image from Saraswathy et al., 2022
somite pcdh8.1 expression spatial pattern, abnormal AB/TU + MO1-mib1 standard conditions Figure 1 with image from Saraswathy et al., 2022
convergent extension involved in gastrulation decreased process quality, abnormal AB/TU + MO1-mib1 standard conditions Figure 1 with image,  Figure 2 with image,  Figure 5 with image from Saraswathy et al., 2022
somite increased width, abnormal AB/TU + MO1-mib1 standard conditions Figure 1 with image from Saraswathy et al., 2022
neural plate dlx3b expression spatial pattern, abnormal AB/TU + MO1-mib1 standard conditions Figure 1 with image from Saraswathy et al., 2022
whole organism flt1 expression decreased amount, abnormal WT + MO1-mib1 standard conditions Fig. S5 from Wang et al., 2016
CiD increased amount, abnormal nns5Tg + MO1-mib1 standard conditions Fig. 3 with image from Okigawa et al., 2014
convergent extension involved in gastrulation decreased process quality, abnormal AB/TU + MO1-mib1 + MO1-wnt5b standard conditions Figure 5 with image from Saraswathy et al., 2022
intersegmental vessel length, ameliorated s843Tg + MO1-mib1 + MO1-mir10b-1 + MO5-mir10a standard conditions Fig. 6 from Wang et al., 2016
intersegmental vessel endothelial cell amount, ameliorated y7Tg + MO1-mib1 + MO1-mir10b-1 + MO5-mir10a standard conditions Fig. 6 from Wang et al., 2016
intersegmental artery angiogenic sprout increased amount, abnormal plcg1y18/y18; plxnd1fov01b/fov01b; y1Tg + MO1-mib1 standard conditions Fig. 6 with image from Zygmunt et al., 2011
intersegmental vessel normal length, ameliorated s916Tg; y7Tg + MO1-dll4 + MO1-mib1 + MO1-mir-ntu1 standard conditions Fig. 5 from Shi et al., 2019
intersegmental vessel blood vessel endothelial cell normal amount, ameliorated s916Tg; y7Tg + MO1-dll4 + MO1-mib1 + MO1-mir-ntu1 standard conditions Fig. 5 from Shi et al., 2019
Citations