Morpholino

MO1-edn1

ID
ZDB-MRPHLNO-060317-3
Name
MO1-edn1
Previous Names
  • EDN-1 (1)
Target
Sequence
5' - GTAGTATGCAAGTCCCGTATTCCAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-edn1
No data available
Phenotype
Phenotype resulting from MO1-edn1
Phenotype Fish Figures
anterior lateral line neuromast increased amount, abnormal WT + MO1-edn1 Fig. 5 with image from Wada et al., 2010
anterior lateral line neuromast mislocalised, abnormal WT + MO1-edn1 Fig. 5 with image from Wada et al., 2010
branchiostegal ray falciform, abnormal WT + MO1-edn1 Fig. 8 with image from Kimmel et al., 2003
branchiostegal ray malformed, abnormal WT + MO1-edn1 Fig. 8 with image from Kimmel et al., 2003
branchiostegal ray position, abnormal WT + MO1-edn1 Fig. 8 with image from Kimmel et al., 2003
ceratobranchial 1 cartilage absent, abnormal WT + MO1-edn1 + MO4-tp53 Fig. 2 from Iklé et al., 2017
ceratobranchial 2 cartilage absent, abnormal WT + MO1-edn1 + MO4-tp53 Fig. 2 from Iklé et al., 2017
ceratobranchial 3 cartilage absent, abnormal WT + MO1-edn1 + MO4-tp53 Fig. 2 from Iklé et al., 2017
ceratobranchial 4 cartilage absent, abnormal WT + MO1-edn1 + MO4-tp53 Fig. 2 from Iklé et al., 2017
ceratohyal cartilage aplastic, abnormal WT + MO1-edn1 Fig. 4 with image from Nissen et al., 2006
ceratohyal cartilage curved ventral, abnormal WT + MO1-edn1 + MO4-tp53 Fig. 2 from Iklé et al., 2017
ceratohyal cartilage hypoplastic, abnormal WT + MO1-edn1 + MO4-tp53 Fig. 2 from Iklé et al., 2017
ceratohyal-branchiostegal ray joint morphology, abnormal WT + MO1-edn1 Fig. 8 with image from Kimmel et al., 2003
infraorbital lateral line neuromast decreased amount, abnormal WT + MO1-edn1 Fig. 7 with image from Kimmel et al., 2003
interhyal-epihyal joint absent, abnormal WT + MO1-edn1 Fig. 3 with image from Walker et al., 2006
mandibular arch skeleton joint absent, abnormal WT + MO1-edn1 Fig. 3 with image from Walker et al., 2006
Meckel's cartilage aplastic, abnormal WT + MO1-edn1 Fig. 4 with image from Nissen et al., 2006
Meckel's cartilage curved ventral, abnormal WT + MO1-edn1 + MO4-tp53 Fig. 2 from Iklé et al., 2017
Meckel's cartilage fused with palatoquadrate cartilage, abnormal WT + MO1-edn1 + MO4-tp53 Fig. 2 from Iklé et al., 2017
Meckel's cartilage hypoplastic, abnormal WT + MO1-edn1 + MO4-tp53 Fig. 2 from Iklé et al., 2017
middle lateral line neuromast decreased amount, abnormal WT + MO1-edn1 Fig. 7 with image from Kimmel et al., 2003
opercle decreased size, abnormal WT + MO1-edn1 Fig. 7 with image,  Fig. Table 2 with image from Kimmel et al., 2003
opercle increased size, abnormal WT + MO1-edn1 Fig. 8 with image from Kimmel et al., 2003
opercle increased width, abnormal WT + MO1-edn1 Fig. 5 with image from Wada et al., 2010
opercle shape, abnormal WT + MO1-edn1 Fig. 5 with image from Wada et al., 2010
opercle size, abnormal WT + MO1-edn1 Fig. 6 with image from Kimmel et al., 2003
opercular lateral line neuromast absent, abnormal WT + MO1-edn1 Fig. 7 with image from Kimmel et al., 2003
opercular lateral line neuromast decreased amount, abnormal WT + MO1-edn1 Fig. Table 2 with image from Kimmel et al., 2003
opercular lateral line neuromast mislocalised dorsally, abnormal WT + MO1-edn1 Fig. 5 with image from Wada et al., 2010
otic lateral line neuromast decreased amount, abnormal WT + MO1-edn1 Fig. 7 with image from Kimmel et al., 2003
pharyngeal arch 1 dlx5a expression absent, abnormal WT + MO1-edn1 + MO4-tp53 Fig. 2 from Iklé et al., 2017
pharyngeal arch 2 dlx5a expression absent, abnormal WT + MO1-edn1 + MO4-tp53 Fig. 2 from Iklé et al., 2017
pharyngeal arch 2 skeleton decreased size, abnormal WT + MO1-edn1 Fig. 6 with image from Kimmel et al., 2003
pharyngeal system development disrupted, abnormal WT + MO1-edn1 Fig. 5 with image from Milan et al., 2006
Phenotype of all Fish created by or utilizing MO1-edn1
Phenotype Fish Conditions Figures
pharyngeal system development disrupted, abnormal WT + MO1-edn1 standard conditions Fig. 5 with image from Milan et al., 2006
branchiostegal ray malformed, abnormal WT + MO1-edn1 standard conditions Fig. 8 with image from Kimmel et al., 2003
pharyngeal arch dlx6a expression absent, abnormal WT + MO1-edn1 heat shock Fig. 2 with image from Alvarado et al., 2016
opercle increased size, abnormal WT + MO1-edn1 standard conditions Fig. 8 with image from Kimmel et al., 2003
opercle increased width, abnormal WT + MO1-edn1 standard conditions Fig. 5 with image from Wada et al., 2010
opercular lateral line neuromast absent, abnormal WT + MO1-edn1 standard conditions Fig. 7 with image from Kimmel et al., 2003
Meckel's cartilage aplastic, abnormal WT + MO1-edn1 standard conditions Fig. 4 with image from Nissen et al., 2006
mandibular arch skeleton joint absent, abnormal WT + MO1-edn1 standard conditions Fig. 3 with image from Walker et al., 2006
branchiostegal ray position, abnormal WT + MO1-edn1 standard conditions Fig. 8 with image from Kimmel et al., 2003
otic lateral line neuromast decreased amount, abnormal WT + MO1-edn1 standard conditions Fig. 7 with image from Kimmel et al., 2003
infraorbital lateral line neuromast decreased amount, abnormal WT + MO1-edn1 standard conditions Fig. 7 with image from Kimmel et al., 2003
ceratohyal-branchiostegal ray joint morphology, abnormal WT + MO1-edn1 standard conditions Fig. 8 with image from Kimmel et al., 2003
opercle size, abnormal WT + MO1-edn1 standard conditions Fig. 6 with image from Kimmel et al., 2003
anterior lateral line neuromast mislocalised, abnormal WT + MO1-edn1 standard conditions Fig. 5 with image from Wada et al., 2010
interhyal-epihyal joint absent, abnormal WT + MO1-edn1 standard conditions Fig. 3 with image from Walker et al., 2006
branchiostegal ray falciform, abnormal WT + MO1-edn1 standard conditions Fig. 8 with image from Kimmel et al., 2003
pharyngeal arch 2 skeleton decreased size, abnormal WT + MO1-edn1 standard conditions Fig. 6 with image from Kimmel et al., 2003
opercle shape, abnormal WT + MO1-edn1 standard conditions Fig. 5 with image from Wada et al., 2010
opercular lateral line neuromast mislocalised dorsally, abnormal WT + MO1-edn1 standard conditions Fig. 5 with image from Wada et al., 2010
ceratohyal cartilage aplastic, abnormal WT + MO1-edn1 standard conditions Fig. 4 with image from Nissen et al., 2006
anterior lateral line neuromast increased amount, abnormal WT + MO1-edn1 standard conditions Fig. 5 with image from Wada et al., 2010
opercle decreased size, abnormal WT + MO1-edn1 standard conditions Fig. 7 with image,  Fig. Table 2 with image from Kimmel et al., 2003
middle lateral line neuromast decreased amount, abnormal WT + MO1-edn1 standard conditions Fig. 7 with image from Kimmel et al., 2003
opercular lateral line neuromast decreased amount, abnormal WT + MO1-edn1 standard conditions Fig. Table 2 with image from Kimmel et al., 2003
ceratobranchial 2 cartilage absent, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratobranchial 4 cartilage absent, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
Meckel's cartilage fused with palatoquadrate cartilage, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratobranchial 1 cartilage absent, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
Meckel's cartilage hypoplastic, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratohyal cartilage hypoplastic, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
pharyngeal arch 2 dlx5a expression absent, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
pharyngeal arch 1 dlx5a expression absent, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratobranchial 3 cartilage absent, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratohyal cartilage curved ventral, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
Meckel's cartilage curved ventral, abnormal WT + MO1-edn1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
pharyngeal arch 1 mesenchyme physical object quality, abnormal Df(Chr01:hand2)s6/s6 + MO1-edn1 standard conditions Fig. 8 with image from Miller et al., 2003
embryonic viscerocranium morphogenesis disrupted, abnormal Df(Chr01:hand2)s6/s6 + MO1-edn1 standard conditions Fig. 8 with image from Miller et al., 2003
cartilaginous joint aplastic, abnormal WT + MO1-edn1 + MO2-grhl3 standard conditions Fig. 4 with image from Dworkin et al., 2014
ceratohyal cartilage hypoplastic, abnormal WT + MO1-edn1 + MO2-grhl3 standard conditions Fig. 4 with image from Dworkin et al., 2014
ceratobranchial cartilage aplastic, abnormal WT + MO1-edn1 + MO2-grhl3 standard conditions Fig. 4 with image from Dworkin et al., 2014
palatoquadrate arch hypoplastic, abnormal WT + MO1-edn1 + MO2-grhl3 standard conditions Fig. 4 with image from Dworkin et al., 2014
Meckel's cartilage hypoplastic, abnormal WT + MO1-edn1 + MO2-grhl3 standard conditions Fig. 4 with image from Dworkin et al., 2014
basihyal cartilage aplastic, abnormal WT + MO1-edn1 + MO2-grhl3 standard conditions Fig. 4 with image from Dworkin et al., 2014
pharyngeal arch dlx6a expression absent, abnormal csu9Tg + MO1-edn1 heat shock Fig. 2 with image from Alvarado et al., 2016
opercular lateral line neuromast premature, abnormal cntnap2ankhgn39dEt; nns8Tg + MO1-edn1 standard conditions Fig. 6 with image from Wada et al., 2010
opercular lateral line neuromast mislocalised dorsally, abnormal cntnap2ankhgn39dEt; nns8Tg + MO1-edn1 standard conditions Fig. 6 with image from Wada et al., 2010
opercle increased width, abnormal cntnap2ankhgn39dEt; nns8Tg + MO1-edn1 standard conditions Fig. 6 with image from Wada et al., 2010
opercle shape, abnormal cntnap2ankhgn39dEt; nns8Tg + MO1-edn1 standard conditions Fig. 6 with image from Wada et al., 2010
opercular lateral line neuromast premature, abnormal tcf7nkhg21cEt; nns8Tg + MO1-edn1 standard conditions Fig. 6 with image from Wada et al., 2010
opercle shape, abnormal tcf7nkhg21cEt; nns8Tg + MO1-edn1 standard conditions Fig. 6 with image from Wada et al., 2010
opercle increased width, abnormal tcf7nkhg21cEt; nns8Tg + MO1-edn1 standard conditions Fig. 6 with image from Wada et al., 2010
opercular lateral line neuromast mislocalised dorsally, abnormal tcf7nkhg21cEt; nns8Tg + MO1-edn1 standard conditions Fig. 6 with image from Wada et al., 2010
Citations