Morpholino

MO1-otx2a

ID
ZDB-MRPHLNO-060620-5
Name
MO1-otx2a
Previous Names
  • MO1-otx1a
  • MO1-otx1l
  • Otx1-like MO-Fluo (1)
Target
Sequence
5' - GAGGTATGACATCATTGTTGAGCCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-otx2a
No data available
Phenotype
Phenotype resulting from MO1-otx2a
No data available
Phenotype of all Fish created by or utilizing MO1-otx2a
Phenotype Fish Conditions Figures
eye perforate, abnormal WT + MO1-otx1 + MO1-otx2a standard conditions Fig. 2 with image from Lane et al., 2012
optic fissure closure incomplete, abnormal WT + MO1-otx1 + MO1-otx2a standard conditions Fig. 2 with image from Lane et al., 2012
retinal pigmented epithelium ventral region absent, abnormal WT + MO1-otx1 + MO1-otx2a standard conditions Fig. 2 with image from Lane et al., 2012
retinal pigmented epithelium anterior side separated from retinal pigmented epithelium posterior side, abnormal WT + MO1-otx1 + MO1-otx2a standard conditions Fig. 2 with image from Lane et al., 2012
eye pigmentation decreased occurrence, abnormal WT + MO1-otx2a + MO1-otx2b standard conditions Fig. 1 with image from Lane et al., 2012
retinal pigmented epithelium ventral region absent, abnormal WT + MO1-otx2a + MO1-otx2b standard conditions Fig. 3 with image from Lane et al., 2012
optic fissure closure incomplete, abnormal WT + MO1-otx2a + MO1-otx2b standard conditions Fig. 2 with image from Lane et al., 2012
eye perforate, abnormal WT + MO1-otx2a + MO1-otx2b standard conditions Fig. 1 with image,  Fig. 2 with image from Lane et al., 2012
retinal pigmented epithelium anterior side separated from retinal pigmented epithelium posterior side, abnormal WT + MO1-otx1 + MO1-otx2a + MO1-otx2b standard conditions Fig. 2 with image from Lane et al., 2012
retinal pigmented epithelium ventral region absent, abnormal WT + MO1-otx1 + MO1-otx2a + MO1-otx2b standard conditions Fig. 2 with image from Lane et al., 2012
rhombomere pax6a expression increased distribution, abnormal WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b standard conditions Fig. 11 with image from Albuixech-Crespo et al., 2017
forebrain pax6a expression increased distribution, abnormal WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b standard conditions Fig. 11 with image from Albuixech-Crespo et al., 2017
hindbrain pax6a expression increased distribution, abnormal WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b standard conditions Fig. 11 with image from Albuixech-Crespo et al., 2017
midbrain hindbrain boundary wnt1 expression absent, abnormal WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b standard conditions Fig. 11 with image from Albuixech-Crespo et al., 2017
midbrain pax6a expression increased distribution, abnormal WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b standard conditions Fig. 11 with image from Albuixech-Crespo et al., 2017
midbrain wnt1 expression decreased amount, abnormal WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b standard conditions Fig. 11 with image from Albuixech-Crespo et al., 2017
zona limitans intrathalamica shha expression absent, abnormal WT + MO1-en2a + MO1-en2b + MO1-otx2a + MO1-otx2b standard conditions Fig. 11 with image from Albuixech-Crespo et al., 2017
Citations