Morpholino

MO1-krit1

ID
ZDB-MRPHLNO-060821-1
Name
MO1-krit1
Previous Names
None
Target
Sequence
5' - GCTTTATTTCACCTCACCTCATAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets the exon 1 donor site.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-krit1
No data available
Phenotype
Phenotype resulting from MO1-krit1
Phenotype of all Fish created by or utilizing MO1-krit1
Phenotype Fish Conditions Figures
sinus venosus dilated, abnormal TU + MO1-krit1 standard conditions Fig. 4 with image from Rosen et al., 2013
atrium dilated, abnormal TU + MO1-krit1 standard conditions Fig. 4 with image from Rosen et al., 2013
heart increased size, abnormal WT + MO1-krit1 standard conditions Fig. S6 from Gore et al., 2008
blood circulation disrupted, abnormal WT + MO1-krit1 standard conditions Fig. S6 from Gore et al., 2008
intersegmental vessel cell-cell junction assembly decreased process quality, abnormal s843Tg + MO1-krit1 standard conditions Fig. 8. with image from Lee et al., 2021
dorsal longitudinal anastomotic vessel cell-cell junction rasip1 expression decreased amount, abnormal s843Tg + MO1-krit1 standard conditions Fig. 8. with image from Lee et al., 2021
intersegmental vessel has fewer parts of type blood vessel endothelial cell, abnormal s843Tg + MO1-krit1 standard conditions Fig. 8. with image from Lee et al., 2021
dorsal longitudinal anastomotic vessel cell-cell junction rasip1 expression mislocalised, abnormal s843Tg + MO1-krit1 standard conditions Fig. 8. with image from Lee et al., 2021
caudal vein plexus sprouting angiogenesis increased occurrence, abnormal s843Tg + MO1-krit1 standard conditions Fig. 6Fig. 7 from Mleynek et al., 2014
caudal vein plexus angiogenic sprout increased amount, abnormal s843Tg + MO1-krit1 standard conditions Fig. 6Fig. 7 from Mleynek et al., 2014
blood vessel morphogenesis decreased process quality, abnormal s843Tg + MO1-krit1 standard conditions Fig. 6Fig. 7 from Mleynek et al., 2014
post-vent vasculature morphology, abnormal s843Tg + MO1-krit1 standard conditions Fig. 6Fig. 7 from Mleynek et al., 2014
angiogenesis process quality, abnormal y1Tg + MO1-krit1 + MO2-krit1 (AB) standard conditions Fig. S3 from Liu et al., 2011
intersegmental vessel malformed, abnormal y1Tg + MO1-krit1 + MO2-krit1 (AB) standard conditions Fig. S3 from Liu et al., 2011
heart increased size, abnormal y1Tg + MO1-krit1 + MO2-krit1 (AB) standard conditions Fig. S3 from Liu et al., 2011
blood circulation process quality, abnormal y1Tg + MO1-krit1 + MO2-krit1 (AB) standard conditions Fig. S3 from Liu et al., 2011
vascular endothelium apoptotic, abnormal y1Tg + MO1-krit1 + MO2-krit1 (AB) standard conditions Fig. 4Fig. 5 from Liu et al., 2010
blood vessel lumenization process quality, abnormal y1Tg + MO1-krit1 + MO2-krit1 (AB) standard conditions Fig. S3 from Liu et al., 2011
intersegmental vessel unlumenized, abnormal y1Tg + MO1-krit1 + MO2-krit1 (AB) standard conditions Fig. S3 from Liu et al., 2011
sinus venosus dilated, abnormal TU + MO1-ccm2l + MO1-krit1 standard conditions Fig. 4 with image from Rosen et al., 2013
blood circulation arrested, abnormal TU + MO1-ccm2l + MO1-krit1 standard conditions Fig. 4 with image from Rosen et al., 2013
atrium dilated, abnormal TU + MO1-ccm2l + MO1-krit1 standard conditions Fig. 4 with image from Rosen et al., 2013
sinus venosus dilated, abnormal TU + MO1-krit1 + MO2-ccm2l standard conditions Fig. 4 with image from Rosen et al., 2013
blood circulation arrested, abnormal TU + MO1-krit1 + MO2-ccm2l standard conditions Fig. 4 with image from Rosen et al., 2013
atrium dilated, abnormal TU + MO1-krit1 + MO2-ccm2l standard conditions Fig. 4 with image from Rosen et al., 2013
intersegmental vessel cell-cell junction assembly decreased process quality, abnormal ncv27Tg + MO1-krit1 standard conditions Fig. 8. with image from Lee et al., 2021
intersegmental vessel sprouting angiogenesis decreased process quality, abnormal ncv27Tg + MO1-krit1 standard conditions Fig. 8. with image from Lee et al., 2021
Citations