Morpholino

MO3-tfap2a

ID
ZDB-MRPHLNO-060927-3
Name
MO3-tfap2a
Previous Names
  • tfap2a1 5.1mo (1)
Target
Sequence
5' - CCTCCATTCTTAGATTTGGCCCTAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
targeted to intron 5 splice acceptor junction
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-tfap2a
No data available
Phenotype
Phenotype resulting from MO3-tfap2a
Phenotype of all Fish created by or utilizing MO3-tfap2a
Phenotype Fish Conditions Figures
medulla oblongata adrenergic neuron absent, abnormal WT + MO3-tfap2a standard conditions Fig. 4 from Kastenhuber et al., 2010
anterior catecholaminergic tract decreased size, abnormal WT + MO3-tfap2a standard conditions Fig. 4 from Kastenhuber et al., 2010
locus coeruleus adrenergic neuron absent, abnormal WT + MO3-tfap2a standard conditions Fig. 4 from Kastenhuber et al., 2010
mandibular arch skeleton malformed, abnormal ir937Tg + MO3-tfap2a standard conditions Fig. 5 from Hoffman et al., 2007
whole organism lacks all parts of type neural crest cell, abnormal WT + MO1-tfap2c + MO3-tfap2a standard conditions Fig. S3 from Zhou et al., 2011
medulla oblongata adrenergic neuron absent, abnormal otpam866/+ + MO3-otpb + MO3-tfap2a (AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
anterior catecholaminergic tract decreased size, abnormal otpam866/+ + MO3-otpb + MO3-tfap2a (AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
locus coeruleus adrenergic neuron absent, abnormal otpam866/+ + MO3-otpb + MO3-tfap2a (AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
anterior catecholaminergic tract absent, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a (AB/TL) standard conditions Fig. 4Fig. 7 from Kastenhuber et al., 2010
preopticohypothalamic tract absent, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a (AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
medial longitudinal catecholaminergic tract absent, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a (AB/TL) standard conditions Fig. 4Fig. 8 from Kastenhuber et al., 2010
diencephalon dopaminergic neuron decreased amount, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a (AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
locus coeruleus adrenergic neuron absent, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a (AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
medulla oblongata adrenergic neuron absent, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a (AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
postoptic commissure decreased size, abnormal otpam866/m866 + MO3-otpb + MO3-tfap2a (AB/TL) standard conditions Fig. 4 from Kastenhuber et al., 2010
neural crest cell decreased amount, abnormal ir937Tg + MO1-tfap2c + MO3-tfap2a standard conditions Fig. 5 from Hoffman et al., 2007
mandibular arch skeleton aplastic, abnormal ir937Tg + MO1-tfap2c + MO3-tfap2a standard conditions Fig. 5 from Hoffman et al., 2007
hematopoietic stem cell decreased amount, abnormal s896Tg; zf169Tg + MO3-tfap2a control Fig. 5 from Damm et al., 2017
Citations