Morpholino

MO1-aplnrb

ID
ZDB-MRPHLNO-070522-4
Name
MO1-aplnrb
Previous Names
  • MO1-agtrl1b
Target
Sequence
5' - CAGAGAAGTTGTTTGTCATGTGCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-aplnrb
No data available
Phenotype
Phenotype resulting from MO1-aplnrb
Phenotype Fish Figures
angioblast cell migration from lateral mesoderm to midline process quality, abnormal y1Tg + MO1-aplnrb Fig. 2 with image from Helker et al., 2015
angiogenic sprout decreased length, abnormal WT + MO1-aplnrb Figure 2 with image from Helker et al., 2020
determination of heart left/right asymmetry process quality, abnormal twu34Tg + MO1-aplnrb Fig. 1 with image from Zhu et al., 2019
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal AB + MO1-aplnrb Fig. 2 with image from Zhu et al., 2019
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO1-aplnrb Fig. 1 with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal AB + MO1-aplnrb Fig. 1 with image from Zhu et al., 2019
endothelial tip cell filopodium decreased length, abnormal WT + MO1-aplnrb Figure 2 with image from Helker et al., 2020
heart aplastic, abnormal WT + MO1-aplnrb Fig. 3 from Zeng et al., 2007
heart decreased size, abnormal twu34Tg + MO1-aplnrb Fig. S2 with image from Zhu et al., 2019
heart looping decreased occurrence, abnormal twu34Tg + MO1-aplnrb Fig. 1 with image from Zhu et al., 2019
heart primordium lft2 expression absent, abnormal AB + MO1-aplnrb Fig. 2 with image from Zhu et al., 2019
heart primordium right side lft2 expression mislocalised, abnormal AB + MO1-aplnrb Fig. 2 with image from Zhu et al., 2019
Kupffer's vesicle decreased size, abnormal AB + MO1-aplnrb Fig. 3 from Zhu et al., 2019
lateral plate mesoderm spaw expression absent, abnormal AB + MO1-aplnrb Fig. 1 with imageFig. 2 with image from Zhu et al., 2019
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO1-aplnrb Fig. 2 with image from Zhu et al., 2019
telencephalon otx5 expression increased distribution, abnormal AB + MO1-aplnrb Fig. 1 with image from Zhu et al., 2019
telencephalon determination of left/right asymmetry in nervous system decreased process quality, abnormal AB + MO1-aplnrb Fig. 1 with image from Zhu et al., 2019
telencephalon lateral side otx5 expression mislocalised, abnormal AB + MO1-aplnrb Fig. 1 with image from Zhu et al., 2019
trunk medial region lft1 expression decreased amount, abnormal AB + MO1-aplnrb Fig. 8 with image from Zhu et al., 2019
Phenotype of all Fish created by or utilizing MO1-aplnrb
Phenotype Fish Conditions Figures
lateral plate mesoderm spaw expression absent, abnormal AB + MO1-aplnrb standard conditions Fig. 1 with imageFig. 2 with image from Zhu et al., 2019
telencephalon determination of left/right asymmetry in nervous system decreased process quality, abnormal AB + MO1-aplnrb standard conditions Fig. 1 with image from Zhu et al., 2019
telencephalon otx5 expression increased distribution, abnormal AB + MO1-aplnrb standard conditions Fig. 1 with image from Zhu et al., 2019
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO1-aplnrb standard conditions Fig. 2 with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal AB + MO1-aplnrb standard conditions Fig. 1 with image from Zhu et al., 2019
heart primordium lft2 expression absent, abnormal AB + MO1-aplnrb standard conditions Fig. 2 with image from Zhu et al., 2019
trunk medial region lft1 expression decreased amount, abnormal AB + MO1-aplnrb standard conditions Fig. 8 with image from Zhu et al., 2019
Kupffer's vesicle decreased size, abnormal AB + MO1-aplnrb standard conditions Fig. 3 from Zhu et al., 2019
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO1-aplnrb standard conditions Fig. 1 with image from Zhu et al., 2019
heart primordium right side lft2 expression mislocalised, abnormal AB + MO1-aplnrb standard conditions Fig. 2 with image from Zhu et al., 2019
telencephalon lateral side otx5 expression mislocalised, abnormal AB + MO1-aplnrb standard conditions Fig. 1 with image from Zhu et al., 2019
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal AB + MO1-aplnrb standard conditions Fig. 2 with image from Zhu et al., 2019
heart aplastic, abnormal WT + MO1-aplnrb standard conditions Fig. 3 from Zeng et al., 2007
angiogenic sprout decreased length, abnormal WT + MO1-aplnrb standard conditions Figure 2 with image from Helker et al., 2020
endothelial tip cell filopodium decreased length, abnormal WT + MO1-aplnrb standard conditions Figure 2 with image from Helker et al., 2020
heart decreased size, abnormal twu34Tg + MO1-aplnrb standard conditions Fig. S2 with image from Zhu et al., 2019
heart looping decreased occurrence, abnormal twu34Tg + MO1-aplnrb standard conditions Fig. 1 with image from Zhu et al., 2019
determination of heart left/right asymmetry process quality, abnormal twu34Tg + MO1-aplnrb standard conditions Fig. 1 with image from Zhu et al., 2019
angioblast cell migration from lateral mesoderm to midline process quality, abnormal y1Tg + MO1-aplnrb control Fig. 2 with image from Helker et al., 2015
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO1-apela + MO1-aplnrb standard conditions Fig. 5\ with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal AB + MO1-apela + MO1-aplnrb standard conditions Fig. 5\ with image from Zhu et al., 2019
liver cp expression decreased amount, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 1 with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 1 with image from Zhu et al., 2019
liver cp expression spatial pattern, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 1 with image from Zhu et al., 2019
forerunner cell group foxj1a expression decreased distribution, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 4 with image from Zhu et al., 2019
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 1 with image from Zhu et al., 2019
forerunner cell group foxj1a expression decreased amount, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 4 with image from Zhu et al., 2019
forerunner cell group sox17 expression decreased amount, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 4 with image from Zhu et al., 2019
liver morphology, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 1 with image from Zhu et al., 2019
Kupffer's vesicle decreased size, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 3 from Zhu et al., 2019
Kupffer's vesicle absent, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 3 from Zhu et al., 2019
forerunner cell group sox17 expression decreased distribution, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 4 with image from Zhu et al., 2019
forerunner cell group sox17 expression spatial pattern, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 4 with image from Zhu et al., 2019
nucleate erythrocyte increased accumulation blood island, abnormal WT + MO1-aplnra + MO1-aplnrb standard conditions Fig. 4 with image from Chng et al., 2013
heart contraction arrested, abnormal WT + MO1-aplnra + MO1-aplnrb standard conditions Fig. 4 with image from Chng et al., 2013
blood circulation arrested, abnormal WT + MO1-aplnra + MO1-aplnrb standard conditions Fig. 4 with image from Chng et al., 2013
heart dysplastic, abnormal WT + MO1-aplnra + MO1-aplnrb standard conditions Fig. 4 with image from Chng et al., 2013
mesoderm migration involved in gastrulation disrupted, abnormal WT + MO1-aplnrb + MO7-aplnra standard conditions Fig. 5 from Pauli et al., 2014
angioblast cell migration from lateral mesoderm to midline arrested, abnormal y1Tg + MO1-aplnra + MO1-aplnrb control Fig. 2 with image from Helker et al., 2015
Citations