Morpholino

MO1-aplnra

ID
ZDB-MRPHLNO-070525-6
Name
MO1-aplnra
Previous Names
  • MO1-agtrl1a
Target
Sequence
5' - TGTATTCCGACGTTGGCTCCATTTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-aplnra
No data available
Phenotype
Phenotype resulting from MO1-aplnra
Phenotype Fish Figures
angioblast cell migration from lateral mesoderm to midline process quality, abnormal y1Tg + MO1-aplnra Fig. 2 with image from Helker et al., 2015
determination of heart left/right asymmetry process quality, abnormal twu34Tg + MO1-aplnra Fig. 1 with image from Zhu et al., 2019
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal AB + MO1-aplnra Fig. 2 with image from Zhu et al., 2019
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO1-aplnra Fig. 1 with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal AB + MO1-aplnra Fig. 1 with image from Zhu et al., 2019
forerunner cell group sox17 expression decreased amount, abnormal AB + MO1-aplnra Fig. 4 with image from Zhu et al., 2019
forerunner cell group foxj1a expression decreased amount, abnormal AB + MO1-aplnra Fig. 4 with image from Zhu et al., 2019
forerunner cell group foxj1a expression decreased distribution, abnormal AB + MO1-aplnra Fig. 4 with image from Zhu et al., 2019
forerunner cell group sox17 expression decreased distribution, abnormal AB + MO1-aplnra Fig. 4 with image from Zhu et al., 2019
forerunner cell group sox17 expression spatial pattern, abnormal AB + MO1-aplnra Fig. 4 with image from Zhu et al., 2019
heart decreased size, abnormal twu34Tg + MO1-aplnra Fig. 1 with imageFig. S2 with image from Zhu et al., 2019
heart looping decreased occurrence, abnormal twu34Tg + MO1-aplnra Fig. 1 with image from Zhu et al., 2019
heart primordium lft2 expression absent, abnormal AB + MO1-aplnra Fig. 2 with image from Zhu et al., 2019
heart primordium right side lft2 expression mislocalised, abnormal AB + MO1-aplnra Fig. 2 with image from Zhu et al., 2019
Kupffer's vesicle absent, abnormal AB + MO1-aplnra Fig. 3 from Zhu et al., 2019
Kupffer's vesicle decreased size, abnormal AB + MO1-aplnra Fig. 3 from Zhu et al., 2019
Kupffer's vesicle cilium decreased amount, abnormal AB + MO1-aplnra Fig. 3 from Zhu et al., 2019
Kupffer's vesicle cilium decreased length, abnormal AB + MO1-aplnra Fig. 3 from Zhu et al., 2019
lateral plate mesoderm spaw expression absent, abnormal AB + MO1-aplnra Fig. 2 with image from Zhu et al., 2019
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO1-aplnra Fig. 2 with image from Zhu et al., 2019
liver cp expression decreased amount, abnormal AB + MO1-aplnra Fig. 1 with image from Zhu et al., 2019
liver morphology, abnormal AB + MO1-aplnra Fig. 1 with image from Zhu et al., 2019
liver cp expression spatial pattern, abnormal AB + MO1-aplnra Fig. 1 with image from Zhu et al., 2019
telencephalon lateral side otx5 expression mislocalised, abnormal AB + MO1-aplnra Fig. 1 with image from Zhu et al., 2019
trunk medial region lft1 expression decreased amount, abnormal AB + MO1-aplnra Fig. 8 with image from Zhu et al., 2019
Phenotype of all Fish created by or utilizing MO1-aplnra
Phenotype Fish Conditions Figures
liver cp expression decreased amount, abnormal AB + MO1-aplnra standard conditions Fig. 1 with image from Zhu et al., 2019
lateral plate mesoderm spaw expression absent, abnormal AB + MO1-aplnra standard conditions Fig. 2 with image from Zhu et al., 2019
lateral plate mesoderm right side spaw expression mislocalised, abnormal AB + MO1-aplnra standard conditions Fig. 2 with image from Zhu et al., 2019
liver cp expression spatial pattern, abnormal AB + MO1-aplnra standard conditions Fig. 1 with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal AB + MO1-aplnra standard conditions Fig. 1 with image from Zhu et al., 2019
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO1-aplnra standard conditions Fig. 1 with image from Zhu et al., 2019
heart primordium lft2 expression absent, abnormal AB + MO1-aplnra standard conditions Fig. 2 with image from Zhu et al., 2019
forerunner cell group foxj1a expression decreased distribution, abnormal AB + MO1-aplnra standard conditions Fig. 4 with image from Zhu et al., 2019
forerunner cell group sox17 expression decreased amount, abnormal AB + MO1-aplnra standard conditions Fig. 4 with image from Zhu et al., 2019
trunk medial region lft1 expression decreased amount, abnormal AB + MO1-aplnra standard conditions Fig. 8 with image from Zhu et al., 2019
liver morphology, abnormal AB + MO1-aplnra standard conditions Fig. 1 with image from Zhu et al., 2019
Kupffer's vesicle decreased size, abnormal AB + MO1-aplnra standard conditions Fig. 3 from Zhu et al., 2019
Kupffer's vesicle cilium decreased length, abnormal AB + MO1-aplnra standard conditions Fig. 3 from Zhu et al., 2019
forerunner cell group foxj1a expression decreased amount, abnormal AB + MO1-aplnra standard conditions Fig. 4 with image from Zhu et al., 2019
Kupffer's vesicle cilium decreased amount, abnormal AB + MO1-aplnra standard conditions Fig. 3 from Zhu et al., 2019
heart primordium right side lft2 expression mislocalised, abnormal AB + MO1-aplnra standard conditions Fig. 2 with image from Zhu et al., 2019
forerunner cell group sox17 expression decreased distribution, abnormal AB + MO1-aplnra standard conditions Fig. 4 with image from Zhu et al., 2019
Kupffer's vesicle absent, abnormal AB + MO1-aplnra standard conditions Fig. 3 from Zhu et al., 2019
telencephalon lateral side otx5 expression mislocalised, abnormal AB + MO1-aplnra standard conditions Fig. 1 with image from Zhu et al., 2019
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal AB + MO1-aplnra standard conditions Fig. 2 with image from Zhu et al., 2019
forerunner cell group sox17 expression spatial pattern, abnormal AB + MO1-aplnra standard conditions Fig. 4 with image from Zhu et al., 2019
heart looping decreased occurrence, abnormal twu34Tg + MO1-aplnra standard conditions Fig. 1 with image from Zhu et al., 2019
heart decreased size, abnormal twu34Tg + MO1-aplnra standard conditions Fig. 1 with imageFig. S2 with image from Zhu et al., 2019
determination of heart left/right asymmetry process quality, abnormal twu34Tg + MO1-aplnra standard conditions Fig. 1 with image from Zhu et al., 2019
angioblast cell migration from lateral mesoderm to midline process quality, abnormal y1Tg + MO1-aplnra control Fig. 2 with image from Helker et al., 2015
heart development disrupted, abnormal aplnrbs608/s608 + MO1-aplnra standard conditions Fig. 2 from Scott et al., 2007
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO1-apela + MO1-aplnra standard conditions Fig. 5\ with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal AB + MO1-apela + MO1-aplnra standard conditions Fig. 5\ with image from Zhu et al., 2019
liver cp expression decreased amount, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 1 with image from Zhu et al., 2019
determination of liver left/right asymmetry process quality, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 1 with image from Zhu et al., 2019
liver cp expression spatial pattern, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 1 with image from Zhu et al., 2019
forerunner cell group foxj1a expression decreased distribution, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 4 with image from Zhu et al., 2019
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 1 with image from Zhu et al., 2019
forerunner cell group foxj1a expression decreased amount, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 4 with image from Zhu et al., 2019
forerunner cell group sox17 expression decreased amount, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 4 with image from Zhu et al., 2019
liver morphology, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 1 with image from Zhu et al., 2019
Kupffer's vesicle decreased size, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 3 from Zhu et al., 2019
Kupffer's vesicle absent, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 3 from Zhu et al., 2019
forerunner cell group sox17 expression decreased distribution, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 4 with image from Zhu et al., 2019
forerunner cell group sox17 expression spatial pattern, abnormal AB + MO1-aplnra + MO1-aplnrb standard conditions Fig. 4 with image from Zhu et al., 2019
nucleate erythrocyte increased accumulation blood island, abnormal WT + MO1-aplnra + MO1-aplnrb standard conditions Fig. 4 with image from Chng et al., 2013
heart contraction arrested, abnormal WT + MO1-aplnra + MO1-aplnrb standard conditions Fig. 4 with image from Chng et al., 2013
blood circulation arrested, abnormal WT + MO1-aplnra + MO1-aplnrb standard conditions Fig. 4 with image from Chng et al., 2013
heart dysplastic, abnormal WT + MO1-aplnra + MO1-aplnrb standard conditions Fig. 4 with image from Chng et al., 2013
angioblast cell migration from lateral mesoderm to midline arrested, abnormal y1Tg + MO1-aplnra + MO1-aplnrb control Fig. 2 with image from Helker et al., 2015
Citations