Morpholino

MO3-mef2d,mef2ca

ID
ZDB-MRPHLNO-070730-5
Name
MO3-mef2d,mef2ca
Previous Names
  • MO2-mef2d/c
  • MO3-mef2d+mef2c
  • MO3-mef2d+mef2ca
Targets
Sequence
5' - GAATCTGGATCTTTTTCCTCCCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Perfect match to mef2d sequence, very close to mef2c, predicted to knock down translation of both genes.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-mef2d,mef2ca
No data available
Phenotype
Phenotype resulting from MO3-mef2d,mef2ca
No data available
Phenotype of all Fish created by or utilizing MO3-mef2d,mef2ca
Phenotype Fish Conditions Figures
skeletal muscle myosin thick filament assembly disrupted, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. 6 with image from Hinits et al., 2007
slow muscle cell immature, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. 3 with image from Hinits et al., 2007
heart rudiment cardiac muscle cell disorganized, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. 5 with image from Hinits et al., 2012
post-vent region curved ventral, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. 2 with image from Hinits et al., 2007
heart formation arrested, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. S5 with image from Hinits et al., 2012
fast muscle cell myofibril composition, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. 2 with imageFig. 6 with image from Hinits et al., 2007
heart rudiment aplastic, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. S5 with image from Hinits et al., 2012
heart aplastic, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. S5 with image from Hinits et al., 2012
myofibril assembly disrupted, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. 2 with imageFig. 3 with image from Hinits et al., 2007
slow muscle cell myofibril composition, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. 3 with imageFig. 6 with image from Hinits et al., 2007
cardiac muscle cell undifferentiated, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. S5 with image from Hinits et al., 2012
cardiac muscle cell differentiation arrested, abnormal WT + MO3-mef2d,mef2ca standard conditions Fig. S5 with image from Hinits et al., 2012
intersegmental vessel decreased length, abnormal y1Tg + MO3-mef2d,mef2ca standard conditions Fig. S4 with image from Hinits et al., 2012
intersegmental vessel morphology, abnormal y1Tg + MO3-mef2d,mef2ca standard conditions Fig. S4 with image from Hinits et al., 2012
Citations