Morpholino

MO1-snai1b

ID
ZDB-MRPHLNO-080310-1
Name
MO1-snai1b
Previous Names
None
Target
Sequence
5' - TGCAAATATCCCCTCGAAACTTCAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker corresponding to bases -28 to -4 relative to start codon
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-snai1b
No data available
Phenotype
Phenotype resulting from MO1-snai1b
Phenotype Fish Figures
atrium position, abnormal twu34Tg + MO1-snai1b Fig. 1 with image from Qiao et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation delayed, abnormal AB + MO1-snai1b Fig. 2 with image from Qiao et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation process quality, abnormal AB + MO1-snai1b Fig. 2 with image from Qiao et al., 2014
cardiac ventricle decreased size, abnormal twu34Tg + MO1-snai1b Fig. 1 with image from Qiao et al., 2014
cardioblast cell midline fusion delayed, abnormal AB + MO1-snai1b Fig. 2 with image from Qiao et al., 2014
cell migration involved in gastrulation decreased rate, abnormal WT + MO1-snai1b Fig. 5 with image from Blanco et al., 2007
cell migration to the midline involved in heart development delayed, abnormal AB + MO1-snai1b Fig. 2 with image from Qiao et al., 2014
cell migration to the midline involved in heart development process quality, abnormal AB + MO1-snai1b Fig. 2 with image from Qiao et al., 2014
cell-cell adhesion increased occurrence, abnormal WT + MO1-snai1b Fig. 5 with image from Blanco et al., 2007
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-snai1b Fig. 1 with image from Blanco et al., 2007
heart looping process quality, abnormal twu34Tg + MO1-snai1b Fig. 1 with image,  Fig. 2 with image from Qiao et al., 2014
pericardium edematous, abnormal AB + MO1-snai1b Fig. 1 with image,  Fig. 2 with image from Qiao et al., 2014
polster increased length, abnormal WT + MO1-snai1b Fig. 3 with image from Blanco et al., 2007
polster morphology, abnormal WT + MO1-snai1b Fig. 3 with image from Blanco et al., 2007
post-vent region decreased length, abnormal WT + MO1-snai1b Fig. 1 with image from Blanco et al., 2007
posterior lateral line has fewer parts of type posterior lateral line neuromast, abnormal zf106Tg + MO1-snai1b Fig. 3 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region etv4 expression decreased amount, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region ackr3b expression decreased amount, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region ackr3b expression decreased distribution, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region lef1 expression increased amount, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region cxcr4b expression increased amount, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region ackr3b expression increased amount, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region lef1 expression mislocalised, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region cxcr4b expression mislocalised, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region ackr3b expression mislocalised, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium central region etv4 expression decreased amount, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium central region lef1 expression increased amount, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium central region cxcr4b expression increased amount, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium central region cxcr4b expression mislocalised, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium central region lef1 expression mislocalised, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium posterior lateral line neuromast deposition delayed, abnormal zf106Tg + MO1-snai1b Fig. 3 with image from Neelathi et al., 2018
posterior lateral line primordium posterior lateral line neuromast primordium migration decreased rate, abnormal zf106Tg + MO1-snai1b Fig. 3 with image,  Fig. 4 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region cdh2 expression decreased amount, abnormal zf106Tg + MO1-snai1b Fig. 4 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region etv4 expression decreased amount, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region epcam expression increased amount, abnormal zf106Tg + MO1-snai1b Fig. 4 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region lef1 expression increased amount, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region lef1 expression increased distribution, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region lef1 expression mislocalised, abnormal zf106Tg + MO1-snai1b Fig. 5 with image from Neelathi et al., 2018
prechordal plate elongated, abnormal WT + MO1-snai1b Fig. 7 with image from Blanco et al., 2007
prechordal plate increased size, abnormal WT + MO1-snai1b Fig. S3 with image from Blanco et al., 2007
prechordal plate shape, abnormal WT + MO1-snai1b Fig. S3 with image from Blanco et al., 2007
somite shape, abnormal WT + MO1-snai1b Fig. 2 with image from Blanco et al., 2007
somite border morphology, abnormal AB + MO1-snai1b Fig. S7 with image from Qiao et al., 2014
trunk decreased length, abnormal WT + MO1-snai1b Fig. 1 with image from Blanco et al., 2007
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-snai1b Fig. 1 with image from Blanco et al., 2007
Phenotype of all Fish created by or utilizing MO1-snai1b
Phenotype Fish Conditions Figures
somite border morphology, abnormal AB + MO1-snai1b standard conditions Fig. S7 with image from Qiao et al., 2014
heart looping process quality, abnormal AB + MO1-snai1b standard conditions Fig. 1 with image,  Fig. 2 with image from Qiao et al., 2014
cardioblast cell midline fusion delayed, abnormal AB + MO1-snai1b standard conditions Fig. 2 with image from Qiao et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation delayed, abnormal AB + MO1-snai1b standard conditions Fig. 2 with image from Qiao et al., 2014
cell migration to the midline involved in heart development process quality, abnormal AB + MO1-snai1b standard conditions Fig. 2 with image from Qiao et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation process quality, abnormal AB + MO1-snai1b standard conditions Fig. 2 with image from Qiao et al., 2014
pericardium edematous, abnormal AB + MO1-snai1b standard conditions Fig. 1 with image,  Fig. 2 with image from Qiao et al., 2014
cell migration to the midline involved in heart development delayed, abnormal AB + MO1-snai1b standard conditions Fig. 2 with image from Qiao et al., 2014
prechordal plate increased size, abnormal WT + MO1-snai1b standard conditions Fig. S3 with image from Blanco et al., 2007
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-snai1b standard conditions Fig. 1 with image from Blanco et al., 2007
post-vent region decreased length, abnormal WT + MO1-snai1b standard conditions Fig. 1 with image from Blanco et al., 2007
polster morphology, abnormal WT + MO1-snai1b standard conditions Fig. 3 with image from Blanco et al., 2007
polster increased length, abnormal WT + MO1-snai1b standard conditions Fig. 3 with image from Blanco et al., 2007
cell-cell adhesion increased occurrence, abnormal WT + MO1-snai1b standard conditions Fig. 5 with image from Blanco et al., 2007
somite shape, abnormal WT + MO1-snai1b standard conditions Fig. 2 with image from Blanco et al., 2007
prechordal plate elongated, abnormal WT + MO1-snai1b standard conditions Fig. 7 with image from Blanco et al., 2007
cell migration involved in gastrulation decreased rate, abnormal WT + MO1-snai1b standard conditions Fig. 5 with image from Blanco et al., 2007
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-snai1b standard conditions Fig. 1 with image from Blanco et al., 2007
prechordal plate shape, abnormal WT + MO1-snai1b standard conditions Fig. S3 with image from Blanco et al., 2007
trunk decreased length, abnormal WT + MO1-snai1b standard conditions Fig. 1 with image from Blanco et al., 2007
cardiac ventricle decreased size, abnormal twu34Tg + MO1-snai1b standard conditions Fig. 1 with image from Qiao et al., 2014
atrium position, abnormal twu34Tg + MO1-snai1b standard conditions Fig. 1 with image from Qiao et al., 2014
heart looping process quality, abnormal twu34Tg + MO1-snai1b standard conditions Fig. 1 with image from Qiao et al., 2014
posterior lateral line primordium posterior region etv4 expression decreased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region cxcr4b expression increased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium posterior lateral line neuromast primordium migration decreased rate, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 3 with image,  Fig. 4 with image from Neelathi et al., 2018
posterior lateral line primordium posterior lateral line neuromast deposition delayed, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 3 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region lef1 expression mislocalised, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region etv4 expression decreased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region ackr3b expression increased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region lef1 expression increased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line has fewer parts of type posterior lateral line neuromast, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 3 with image from Neelathi et al., 2018
posterior lateral line primordium central region lef1 expression mislocalised, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region lef1 expression increased distribution, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium central region cxcr4b expression increased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region lef1 expression increased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region epcam expression increased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 4 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region ackr3b expression decreased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region ackr3b expression mislocalised, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium central region cxcr4b expression mislocalised, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium central region lef1 expression increased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium central region etv4 expression decreased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium posterior region cdh2 expression decreased amount, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 4 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region cxcr4b expression mislocalised, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region ackr3b expression decreased distribution, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
posterior lateral line primordium anterior region lef1 expression mislocalised, abnormal zf106Tg + MO1-snai1b standard conditions Fig. 5 with image from Neelathi et al., 2018
prechordal plate mislocalised posteriorly, abnormal WT + MO1-snai1b + MO2-snai1a + MO3-snai1a standard conditions Fig. 7 with image from Blanco et al., 2007
prechordal plate elongated, abnormal WT + MO1-snai1b + MO2-snai1a + MO3-snai1a standard conditions Fig. 7 with image from Blanco et al., 2007
posterior lateral line primordium posterior lateral line neuromast primordium migration rate, ameliorated zf106Tg + MO1-epcam + MO1-snai1b standard conditions Fig. 4 with image from Neelathi et al., 2018
Citations