Morpholino

MO1-cep290

ID
ZDB-MRPHLNO-080428-2
Name
MO1-cep290
Previous Names
  • ATG-MO (1)
  • MO6-cep290
Target
Sequence
5' - GCCGCAGGCATTCTTCAGGTCAGCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cep290
No data available
Phenotype
Phenotype resulting from MO1-cep290
Phenotype Fish Figures
axis curved, abnormal AB/TU + MO1-cep290 Fig. 1. with image from Cardenas-Rodriguez et al., 2021
axis curved ventral, abnormal AB/TU + MO1-cep290 Fig. S1 from Cardenas-Rodriguez et al., 2021
brain hydrocephalic, abnormal WT + MO1-cep290 Fig. S1 from Slaats et al., 2015
Fig. 4 from Murga-Zamalloa et al., 2011
brain infiltrative, abnormal WT + MO1-cep290 Fig. 3 from Sayer et al., 2006
cerebellum organization quality, abnormal WT + MO1-cep290 Fig. 3 from Sayer et al., 2006
cerebellum development disrupted, abnormal WT + MO1-cep290 Fig. 3 from Sayer et al., 2006
cerebellum structural organization disrupted, abnormal WT + MO1-cep290 Fig. 3 from Sayer et al., 2006
cloacal septation disrupted, abnormal WT + MO1-cep290 Fig. 3 from Sayer et al., 2006
eye decreased size, abnormal WT + MO1-cep290 Fig. S1 from Slaats et al., 2015
Fig. 4 from Murga-Zamalloa et al., 2011
Fig. 3 from Sayer et al., 2006
fourth ventricle composition, abnormal WT + MO1-cep290 Fig. 3 from Sayer et al., 2006
heart determination of heart left/right asymmetry process quality, abnormal AB/TU + MO1-cep290 Fig. S1 from Cardenas-Rodriguez et al., 2021
kidney cystic, abnormal AB/TU + MO1-cep290 Fig. S1 from Cardenas-Rodriguez et al., 2021
nervous system development disrupted, abnormal WT + MO1-cep290 Fig. 3 from Sayer et al., 2006
otic vesicle formation disrupted, abnormal WT + MO1-cep290 Fig. 3 from Sayer et al., 2006
otolith amount, abnormal AB/TU + MO1-cep290 Fig. S1 from Cardenas-Rodriguez et al., 2021
pericardium edematous, abnormal WT + MO1-cep290 Fig. S1 from Slaats et al., 2015
Fig. 4 from Murga-Zamalloa et al., 2011
post-vent region curved, abnormal AB/TU + MO1-cep290 Fig. 1. with image from Cardenas-Rodriguez et al., 2021
post-vent region curved ventral, abnormal WT + MO1-cep290 Fig. S1 from Cardenas-Rodriguez et al., 2021
Fig. 4 from Murga-Zamalloa et al., 2011
post-vent region increased curvature, abnormal WT + MO1-cep290 Fig. 4 from Murga-Zamalloa et al., 2011
pronephric glomerulus cystic, abnormal WT + MO1-cep290 Fig. 3 from Sayer et al., 2006
pronephric tubule cystic, abnormal WT + MO1-cep290 Fig. 3 from Sayer et al., 2006
retinal photoreceptor layer lacks all parts of type photoreceptor cell photoreceptor outer segment, abnormal WT + MO1-cep290 Fig. 4 from Murga-Zamalloa et al., 2011
signal transduction in response to DNA damage increased magnitude, abnormal WT + MO1-cep290 Fig. 1 from Slaats et al., 2015
trunk curved ventral, abnormal WT + MO1-cep290 Fig. S1 from Slaats et al., 2015
whole organism cep290 expression absent, abnormal AB/TU + MO1-cep290 Fig. 1. with image from Cardenas-Rodriguez et al., 2021
whole organism dead, abnormal WT + MO1-cep290 Fig. S1 from Slaats et al., 2015
whole organism decreased pigmentation, abnormal WT + MO1-cep290 Fig. S1 from Slaats et al., 2015
Phenotype of all Fish created by or utilizing MO1-cep290
Phenotype Fish Conditions Figures
axis curved, abnormal AB/TU + MO1-cep290 control Fig. 1. with image from Cardenas-Rodriguez et al., 2021
otolith amount, abnormal AB/TU + MO1-cep290 control Fig. S1 from Cardenas-Rodriguez et al., 2021
kidney cystic, abnormal AB/TU + MO1-cep290 control Fig. S1 from Cardenas-Rodriguez et al., 2021
axis curved ventral, abnormal AB/TU + MO1-cep290 control Fig. S1 from Cardenas-Rodriguez et al., 2021
heart determination of heart left/right asymmetry process quality, abnormal AB/TU + MO1-cep290 control Fig. S1 from Cardenas-Rodriguez et al., 2021
whole organism cep290 expression absent, abnormal AB/TU + MO1-cep290 control Fig. 1. with image from Cardenas-Rodriguez et al., 2021
post-vent region curved, abnormal AB/TU + MO1-cep290 control Fig. 1. with image from Cardenas-Rodriguez et al., 2021
post-vent region curved ventral, abnormal AB/TU + MO1-cep290 control Fig. S1 from Cardenas-Rodriguez et al., 2021
post-vent region curved ventral, abnormal WT + MO1-cep290 standard conditions Fig. 4 from Murga-Zamalloa et al., 2011
cerebellum structural organization disrupted, abnormal WT + MO1-cep290 standard conditions Fig. 3 from Sayer et al., 2006
post-vent region increased curvature, abnormal WT + MO1-cep290 standard conditions Fig. 4 from Murga-Zamalloa et al., 2011
nervous system development disrupted, abnormal WT + MO1-cep290 standard conditions Fig. 3 from Sayer et al., 2006
pronephric glomerulus cystic, abnormal WT + MO1-cep290 standard conditions Fig. 3 from Sayer et al., 2006
brain infiltrative, abnormal WT + MO1-cep290 standard conditions Fig. 3 from Sayer et al., 2006
brain hydrocephalic, abnormal WT + MO1-cep290 standard conditions Fig. S1 from Slaats et al., 2015
Fig. 4 from Murga-Zamalloa et al., 2011
otic vesicle formation disrupted, abnormal WT + MO1-cep290 standard conditions Fig. 3 from Sayer et al., 2006
retinal photoreceptor layer lacks all parts of type photoreceptor cell photoreceptor outer segment, abnormal WT + MO1-cep290 standard conditions Fig. 4 from Murga-Zamalloa et al., 2011
whole organism decreased pigmentation, abnormal WT + MO1-cep290 standard conditions Fig. S1 from Slaats et al., 2015
eye decreased size, abnormal WT + MO1-cep290 standard conditions Fig. S1 from Slaats et al., 2015
Fig. 4 from Murga-Zamalloa et al., 2011
Fig. 3 from Sayer et al., 2006
fourth ventricle composition, abnormal WT + MO1-cep290 standard conditions Fig. 3 from Sayer et al., 2006
pronephric tubule cystic, abnormal WT + MO1-cep290 standard conditions Fig. 3 from Sayer et al., 2006
trunk curved ventral, abnormal WT + MO1-cep290 standard conditions Fig. S1 from Slaats et al., 2015
whole organism dead, abnormal WT + MO1-cep290 standard conditions Fig. S1 from Slaats et al., 2015
cerebellum organization quality, abnormal WT + MO1-cep290 standard conditions Fig. 3 from Sayer et al., 2006
cerebellum development disrupted, abnormal WT + MO1-cep290 standard conditions Fig. 3 from Sayer et al., 2006
signal transduction in response to DNA damage increased magnitude, abnormal WT + MO1-cep290 standard conditions Fig. 1 from Slaats et al., 2015
pericardium edematous, abnormal WT + MO1-cep290 standard conditions Fig. S1 from Slaats et al., 2015
Fig. 4 from Murga-Zamalloa et al., 2011
cloacal septation disrupted, abnormal WT + MO1-cep290 standard conditions Fig. 3 from Sayer et al., 2006
pronephros cystic, abnormal cc2d2aw38/w38 + MO1-cep290 (AB) standard conditions text only from Gorden et al., 2008
pronephros cystic, exacerbated cc2d2aw38/w38 + MO1-cep290 (AB) standard conditions Fig. 6 from Gorden et al., 2008
eye lacks all parts of type lens, abnormal WT + MO1-cep290 + MO2-mkks standard conditions Fig. 3 from Rachel et al., 2012
tether cell decreased size, abnormal WT + MO1-cep290 + MO2-mkks standard conditions Fig. 3 from Rachel et al., 2012
eye development disrupted, abnormal WT + MO1-cep290 + MO2-mkks standard conditions Fig. 3 from Rachel et al., 2012
ear development disrupted, abnormal WT + MO1-cep290 + MO2-mkks standard conditions Fig. 3 from Rachel et al., 2012
retina layer formation disrupted, abnormal WT + MO1-cep290 + MO2-mkks standard conditions Fig. 3 from Rachel et al., 2012
Citations