Morpholino

MO1-hmx1

ID
ZDB-MRPHLNO-080513-1
Name
MO1-hmx1
Previous Names
None
Target
Sequence
5' - TCTATCCCATAACTTACTCTTGGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hmx1
No data available
Phenotype
Phenotype resulting from MO1-hmx1
Phenotype Fish Figures
brain apoptotic process increased occurrence, abnormal WT + MO1-hmx1 Fig. 5 from Boisset et al., 2012
eye decreased size, abnormal WT + MO1-hmx1 Fig. 2 from Boisset et al., 2012
Fig. 6 from Schorderet et al., 2008
lens opaque, abnormal WT + MO1-hmx1 Fig. 2 from Boisset et al., 2012
lens apoptotic process increased occurrence, abnormal WT + MO1-hmx1 Fig. 5 from Boisset et al., 2012
neural retina development delayed, abnormal WT + MO1-hmx1 Fig. 4 from Boisset et al., 2012
optic cup apoptotic process increased occurrence, abnormal WT + MO1-hmx1 Fig. 5 from Boisset et al., 2012
retina apoptotic process increased occurrence, abnormal WT + MO1-hmx1 Fig. 5 from Boisset et al., 2012
retina cell population proliferation increased occurrence, abnormal WT + MO1-hmx1 Fig. 5 from Boisset et al., 2012
retina development in camera-type eye disrupted, abnormal WT + MO1-hmx1 Fig. 6 from Schorderet et al., 2008
retina layer formation decreased process quality, abnormal WT + MO1-hmx1 Fig. 2 from Boisset et al., 2012
retina morphogenesis in camera-type eye decreased process quality, abnormal WT + MO1-hmx1 Fig. 2 from Boisset et al., 2012
retinal cone cell differentiation delayed, abnormal WT + MO1-hmx1 Fig. 4 from Boisset et al., 2012
retinal inner nuclear layer cell population proliferation increased occurrence, abnormal WT + MO1-hmx1 Fig. 5 from Boisset et al., 2012
retinal neural layer absent, abnormal WT + MO1-hmx1 Fig. 2 from Boisset et al., 2012
retinal outer nuclear layer cell population proliferation increased occurrence, abnormal WT + MO1-hmx1 Fig. 5 from Boisset et al., 2012
retinal pigmented epithelium increased thickness, abnormal WT + MO1-hmx1 Fig. 2 from Boisset et al., 2012
solid lens vesicle apoptotic process decreased occurrence, abnormal WT + MO1-hmx1 Fig. 5 from Boisset et al., 2012
Phenotype of all Fish created by or utilizing MO1-hmx1
Phenotype Fish Conditions Figures
neural retina development delayed, abnormal WT + MO1-hmx1 standard conditions Fig. 4 from Boisset et al., 2012
retinal cone cell differentiation delayed, abnormal WT + MO1-hmx1 standard conditions Fig. 4 from Boisset et al., 2012
brain apoptotic process increased occurrence, abnormal WT + MO1-hmx1 standard conditions Fig. 5 from Boisset et al., 2012
solid lens vesicle apoptotic process decreased occurrence, abnormal WT + MO1-hmx1 standard conditions Fig. 5 from Boisset et al., 2012
retina cell population proliferation increased occurrence, abnormal WT + MO1-hmx1 standard conditions Fig. 5 from Boisset et al., 2012
lens opaque, abnormal WT + MO1-hmx1 standard conditions Fig. 2 from Boisset et al., 2012
eye decreased size, abnormal WT + MO1-hmx1 standard conditions Fig. 2 from Boisset et al., 2012
Fig. 6 from Schorderet et al., 2008
retina layer formation decreased process quality, abnormal WT + MO1-hmx1 standard conditions Fig. 2 from Boisset et al., 2012
retinal neural layer absent, abnormal WT + MO1-hmx1 standard conditions Fig. 2 from Boisset et al., 2012
retinal outer nuclear layer cell population proliferation increased occurrence, abnormal WT + MO1-hmx1 standard conditions Fig. 5 from Boisset et al., 2012
retinal pigmented epithelium increased thickness, abnormal WT + MO1-hmx1 standard conditions Fig. 2 from Boisset et al., 2012
optic cup apoptotic process increased occurrence, abnormal WT + MO1-hmx1 standard conditions Fig. 5 from Boisset et al., 2012
retina morphogenesis in camera-type eye decreased process quality, abnormal WT + MO1-hmx1 standard conditions Fig. 2 from Boisset et al., 2012
retinal inner nuclear layer cell population proliferation increased occurrence, abnormal WT + MO1-hmx1 standard conditions Fig. 5 from Boisset et al., 2012
retina apoptotic process increased occurrence, abnormal WT + MO1-hmx1 standard conditions Fig. 5 from Boisset et al., 2012
lens apoptotic process increased occurrence, abnormal WT + MO1-hmx1 standard conditions Fig. 5 from Boisset et al., 2012
retina development in camera-type eye disrupted, abnormal WT + MO1-hmx1 standard conditions Fig. 6 from Schorderet et al., 2008
Citations