Morpholino

MO1-hmx1

ID

ZDB-MRPHLNO-080513-1

Name

MO1-hmx1

Previous Names

None

Target

hmx1 (1)

Sequence

5' - TCTATCCCATAACTTACTCTTGGAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-hmx1

No data available

Phenotype

Phenotype resulting from MO1-hmx1

Phenotype	Fish	Figures
brain apoptotic process increased occurrence, abnormal	WT + MO1-hmx1	Fig. 5 from Boisset et al., 2012
eye decreased size, abnormal	WT + MO1-hmx1	Fig. 2 from Boisset et al., 2012 Fig. 6 from Schorderet et al., 2008
lens opaque, abnormal	WT + MO1-hmx1	Fig. 2 from Boisset et al., 2012
lens apoptotic process increased occurrence, abnormal	WT + MO1-hmx1	Fig. 5 from Boisset et al., 2012
neural retina development delayed, abnormal	WT + MO1-hmx1	Fig. 4 from Boisset et al., 2012
optic cup apoptotic process increased occurrence, abnormal	WT + MO1-hmx1	Fig. 5 from Boisset et al., 2012
retina apoptotic process increased occurrence, abnormal	WT + MO1-hmx1	Fig. 5 from Boisset et al., 2012
retina cell population proliferation increased occurrence, abnormal	WT + MO1-hmx1	Fig. 5 from Boisset et al., 2012
retina development in camera-type eye disrupted, abnormal	WT + MO1-hmx1	Fig. 6 from Schorderet et al., 2008
retina layer formation decreased process quality, abnormal	WT + MO1-hmx1	Fig. 2 from Boisset et al., 2012
retina morphogenesis in camera-type eye decreased process quality, abnormal	WT + MO1-hmx1	Fig. 2 from Boisset et al., 2012
retinal cone cell differentiation delayed, abnormal	WT + MO1-hmx1	Fig. 4 from Boisset et al., 2012
retinal inner nuclear layer cell population proliferation increased occurrence, abnormal	WT + MO1-hmx1	Fig. 5 from Boisset et al., 2012
retinal neural layer absent, abnormal	WT + MO1-hmx1	Fig. 2 from Boisset et al., 2012
retinal outer nuclear layer cell population proliferation increased occurrence, abnormal	WT + MO1-hmx1	Fig. 5 from Boisset et al., 2012
retinal pigmented epithelium increased thickness, abnormal	WT + MO1-hmx1	Fig. 2 from Boisset et al., 2012
solid lens vesicle apoptotic process decreased occurrence, abnormal	WT + MO1-hmx1	Fig. 5 from Boisset et al., 2012

Phenotype of all Fish created by or utilizing MO1-hmx1

Phenotype	Fish	Conditions	Figures
neural retina development delayed, abnormal	WT + MO1-hmx1	standard conditions	Fig. 4 from Boisset et al., 2012
retinal cone cell differentiation delayed, abnormal	WT + MO1-hmx1	standard conditions	Fig. 4 from Boisset et al., 2012
brain apoptotic process increased occurrence, abnormal	WT + MO1-hmx1	standard conditions	Fig. 5 from Boisset et al., 2012
solid lens vesicle apoptotic process decreased occurrence, abnormal	WT + MO1-hmx1	standard conditions	Fig. 5 from Boisset et al., 2012
retina cell population proliferation increased occurrence, abnormal	WT + MO1-hmx1	standard conditions	Fig. 5 from Boisset et al., 2012
lens opaque, abnormal	WT + MO1-hmx1	standard conditions	Fig. 2 from Boisset et al., 2012
eye decreased size, abnormal	WT + MO1-hmx1	standard conditions	Fig. 2 from Boisset et al., 2012 Fig. 6 from Schorderet et al., 2008
retina layer formation decreased process quality, abnormal	WT + MO1-hmx1	standard conditions	Fig. 2 from Boisset et al., 2012
retinal neural layer absent, abnormal	WT + MO1-hmx1	standard conditions	Fig. 2 from Boisset et al., 2012
retinal outer nuclear layer cell population proliferation increased occurrence, abnormal	WT + MO1-hmx1	standard conditions	Fig. 5 from Boisset et al., 2012
retinal pigmented epithelium increased thickness, abnormal	WT + MO1-hmx1	standard conditions	Fig. 2 from Boisset et al., 2012
optic cup apoptotic process increased occurrence, abnormal	WT + MO1-hmx1	standard conditions	Fig. 5 from Boisset et al., 2012
retina morphogenesis in camera-type eye decreased process quality, abnormal	WT + MO1-hmx1	standard conditions	Fig. 2 from Boisset et al., 2012
retinal inner nuclear layer cell population proliferation increased occurrence, abnormal	WT + MO1-hmx1	standard conditions	Fig. 5 from Boisset et al., 2012
retina apoptotic process increased occurrence, abnormal	WT + MO1-hmx1	standard conditions	Fig. 5 from Boisset et al., 2012
lens apoptotic process increased occurrence, abnormal	WT + MO1-hmx1	standard conditions	Fig. 5 from Boisset et al., 2012
retina development in camera-type eye disrupted, abnormal	WT + MO1-hmx1	standard conditions	Fig. 6 from Schorderet et al., 2008

Citations