Morpholino

MO1-gli2b

ID
ZDB-MRPHLNO-080703-4
Name
MO1-gli2b
Previous Names
  • gli2bATG (1)
Target
Sequence
5' - CGGGAGCTGGAACACCGGCCTCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino that targets gli2b.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gli2b
No data available
Phenotype
Phenotype resulting from MO1-gli2b
Phenotype of all Fish created by or utilizing MO1-gli2b
Phenotype Fish Conditions Figures
floor plate formation disrupted, abnormal WT + MO1-gli2b standard conditions Fig. 6 with image from Ke et al., 2008
hindbrain astrocyte decreased amount, abnormal WT + MO1-gli2b standard conditions Fig. 1 with image from Ke et al., 2008
oligodendrocyte differentiation disrupted, abnormal WT + MO1-gli2b standard conditions Fig. 4 with image from Ke et al., 2008
facial nerve motor nucleus mislocalised laterally, abnormal WT + MO1-gli2b standard conditions Fig. 5 with image from Ke et al., 2008
Rohon-Beard neuron decreased amount, abnormal WT + MO1-gli2b standard conditions Fig. 5 with image from Ke et al., 2008
axonogenesis disrupted, abnormal WT + MO1-gli2b standard conditions Fig. S2 with image from Ke et al., 2008
secondary motor neuron decreased amount, abnormal WT + MO1-gli2b standard conditions Fig. 5 with image from Ke et al., 2008
fourth ventricle increased size, abnormal WT + MO1-gli2b standard conditions text only from Ke et al., 2008
abducens motor nucleus aplastic, abnormal WT + MO1-gli2b standard conditions Fig. 5 with image from Ke et al., 2008
brain decreased size, abnormal WT + MO1-gli2b standard conditions text only from Ke et al., 2008
trigeminal motor nucleus mislocalised laterally, abnormal WT + MO1-gli2b standard conditions Fig. 5 with image from Ke et al., 2008
floor plate rhombomere region increased width, abnormal WT + MO1-gli2b standard conditions Fig. 6 with image from Ke et al., 2008
floor plate formation disrupted, abnormal gli2aty17a/ty17a + MO1-gli2b standard conditions Fig. 6 with image from Ke et al., 2008
facial nerve motor nucleus decreased amount, abnormal gli2aty17a/ty17a + MO1-gli2b standard conditions Fig. 5 with image from Ke et al., 2008
vagal lobe aplastic, abnormal gli2aty17a/ty17a + MO1-gli2b standard conditions Fig. 5 with image from Ke et al., 2008
Rohon-Beard neuron decreased amount, abnormal gli2aty17a/ty17a + MO1-gli2b standard conditions Fig. 5 with image from Ke et al., 2008
trigeminal motor nucleus aplastic, abnormal gli2aty17a/ty17a + MO1-gli2b standard conditions Fig. 5 with image from Ke et al., 2008
Citations