Morpholino

MO1-heg1

ID
ZDB-MRPHLNO-080714-5
Name
MO1-heg1
Previous Names
None
Target
Sequence
5' - GTAATCGTACTTGCAGCAGGTGACA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
designed against intron 11 donor site
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-heg1
No data available
Phenotype
Phenotype resulting from MO1-heg1
Phenotype of all Fish created by or utilizing MO1-heg1
Phenotype Fish Conditions Figures
heart increased size, abnormal WT + MO1-heg1 standard conditions Fig. 6 with image from Serluca, 2008
thymus decreased size, abnormal WT + MO1-heg1 standard conditions Fig. 3 from Wang et al., 2011
thymus hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-heg1 standard conditions Fig. 3 from Wang et al., 2011
pericardium edematous, abnormal WT + MO1-heg1 standard conditions Fig. 6 with image from Serluca, 2008
trunk hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-heg1 standard conditions Fig. 3 from Wang et al., 2011
dorsal longitudinal anastomotic vessel cell-cell junction rasip1 expression mislocalised, abnormal s843Tg + MO1-heg1 standard conditions Fig. 8. with image from Lee et al., 2021
intersegmental vessel cell-cell junction ab1-cdh5 labeling mislocalised, abnormal s843Tg + MO1-heg1 standard conditions Fig. 8. with image from Lee et al., 2021
intersegmental vessel has fewer parts of type blood vessel endothelial cell, abnormal s843Tg + MO1-heg1 standard conditions Fig. 8. with image from Lee et al., 2021
intersegmental vessel cell-cell junction assembly decreased process quality, abnormal s843Tg + MO1-heg1 standard conditions Fig. 8. with image from Lee et al., 2021
dorsal longitudinal anastomotic vessel cell-cell junction rasip1 expression decreased amount, abnormal s843Tg + MO1-heg1 standard conditions Fig. 8. with image from Lee et al., 2021
heart edematous, abnormal y1Tg + MO1-heg1 standard conditions Fig. 4 from Kleaveland et al., 2009
heart dilated, abnormal y1Tg + MO1-heg1 standard conditions Fig. 4 from Kleaveland et al., 2009
blood vasculature obstructed, abnormal y1Tg + MO1-heg1 standard conditions Fig. 4 from Kleaveland et al., 2009
intersegmental vessel cell-cell junction assembly decreased process quality, abnormal ncv27Tg + MO1-heg1 standard conditions Fig. 8. with image from Lee et al., 2021
intersegmental vessel sprouting angiogenesis decreased process quality, abnormal ncv27Tg + MO1-heg1 standard conditions Fig. 8. with image from Lee et al., 2021
endocardium EGFP expression decreased amount, abnormal pbb21Tg; ubs3Tg + MO1-heg1 standard conditions Fig. 1 with image from Donat et al., 2018
Citations