Morpholino

MO2-cnr1

ID
ZDB-MRPHLNO-080805-2
Name
MO2-cnr1
Previous Names
None
Target
Sequence
5' - CTAGAGGAAACCTGTCGGAGGAAAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cnr1
No data available
Phenotype
Phenotype resulting from MO2-cnr1
Phenotype Fish Figures
anterior commissure neuron projection disorganized, abnormal zf103Tg + MO2-cnr1 Figure 3 with image from Zuccarini et al., 2019
anterior commissure morphogenesis disrupted, abnormal WT + MO2-cnr1 Fig. 6 with image from Watson et al., 2008
anterior crista cilium decreased length, abnormal TU + MO2-cnr1 Figure 4 with image from Nguyen et al., 2025
axonal fasciculation disrupted, abnormal WT + MO2-cnr1 Fig. 6 with image from Watson et al., 2008
ciliated cell jag2b expression decreased amount, abnormal TU + MO2-cnr1 Figure 1 with image from Nguyen et al., 2025
ciliated cell cetn4 expression decreased amount, abnormal TU + MO2-cnr1 Figure 1 with image from Nguyen et al., 2025
ciliated cell pax2a expression decreased amount, abnormal TU + MO2-cnr1 Figure 1 with image from Nguyen et al., 2025
ciliated cell cimap1b expression decreased amount, abnormal TU + MO2-cnr1 Figure 1 with image from Nguyen et al., 2025
forebrain neuron projection mislocalised, abnormal zf103Tg + MO2-cnr1 Figure 3 with image from Zuccarini et al., 2019
hair cell anterior macula cilium decreased length, abnormal TU + MO2-cnr1 Figure 4 with image from Nguyen et al., 2025
head stmn2a expression decreased amount, abnormal WT + MO2-cnr1 Figure 6 with image from Zuccarini et al., 2019
head stmn2b expression decreased amount, abnormal WT + MO2-cnr1 Figure 6 with image from Zuccarini et al., 2019
head cnr1 expression decreased amount, abnormal WT + MO2-cnr1 Figure 3 with image from Zuccarini et al., 2019
Kupffer's vesicle cilium decreased length, abnormal TU + MO2-cnr1 Figure 4 with image from Nguyen et al., 2025
medial longitudinal fasciculus structure, abnormal WT + MO2-cnr1 Fig. 6 with image from Watson et al., 2008
nephron ciliated cell decreased amount, abnormal TU + MO2-cnr1 Figure 1 with image from Nguyen et al., 2025
pericardium edematous, abnormal TU + MO2-cnr1 Figure 1 with image from Nguyen et al., 2025
posterior commissure morphogenesis disrupted, abnormal WT + MO2-cnr1 Fig. 6 with image from Watson et al., 2008
pronephros cilium decreased length, abnormal TU + MO2-cnr1 Figure 4 with image from Nguyen et al., 2025
Phenotype of all Fish created by or utilizing MO2-cnr1
Phenotype Fish Conditions Figures
ciliated cell cimap1b expression decreased amount, abnormal TU + MO2-cnr1 standard conditions Figure 1 with image from Nguyen et al., 2025
anterior crista cilium decreased length, abnormal TU + MO2-cnr1 standard conditions Figure 4 with image from Nguyen et al., 2025
ciliated cell cetn4 expression decreased amount, abnormal TU + MO2-cnr1 standard conditions Figure 1 with image from Nguyen et al., 2025
nephron ciliated cell decreased amount, abnormal TU + MO2-cnr1 standard conditions Figure 1 with image from Nguyen et al., 2025
ciliated cell jag2b expression decreased amount, abnormal TU + MO2-cnr1 standard conditions Figure 1 with image from Nguyen et al., 2025
pericardium edematous, abnormal TU + MO2-cnr1 standard conditions Figure 1 with image from Nguyen et al., 2025
Kupffer's vesicle cilium decreased length, abnormal TU + MO2-cnr1 standard conditions Figure 4 with image from Nguyen et al., 2025
pronephros cilium decreased length, abnormal TU + MO2-cnr1 standard conditions Figure 4 with image from Nguyen et al., 2025
ciliated cell pax2a expression decreased amount, abnormal TU + MO2-cnr1 standard conditions Figure 1 with image from Nguyen et al., 2025
hair cell anterior macula cilium decreased length, abnormal TU + MO2-cnr1 standard conditions Figure 4 with image from Nguyen et al., 2025
head stmn2b expression decreased amount, abnormal WT + MO2-cnr1 standard conditions Figure 6 with image from Zuccarini et al., 2019
head stmn2a expression decreased amount, abnormal WT + MO2-cnr1 standard conditions Figure 6 with image from Zuccarini et al., 2019
axonal fasciculation disrupted, abnormal WT + MO2-cnr1 standard conditions Fig. 6 with image from Watson et al., 2008
head cnr1 expression decreased amount, abnormal WT + MO2-cnr1 standard conditions Figure 3 with image from Zuccarini et al., 2019
anterior commissure morphogenesis disrupted, abnormal WT + MO2-cnr1 standard conditions Fig. 6 with image from Watson et al., 2008
posterior commissure morphogenesis disrupted, abnormal WT + MO2-cnr1 standard conditions Fig. 6 with image from Watson et al., 2008
medial longitudinal fasciculus structure, abnormal WT + MO2-cnr1 standard conditions Fig. 6 with image from Watson et al., 2008
anterior commissure neuron projection disorganized, abnormal zf103Tg + MO2-cnr1 standard conditions Figure 3 with image from Zuccarini et al., 2019
forebrain neuron projection mislocalised, abnormal zf103Tg + MO2-cnr1 standard conditions Figure 3 with image from Zuccarini et al., 2019
Citations