Morpholino

MO2-invs

ID
ZDB-MRPHLNO-080929-3
Name
MO2-invs
Previous Names
  • inv-MO (1)
Target
Sequence
5' - GGAGCAGCATTGCCATAGTGATGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-invs
No data available
Phenotype
Phenotype resulting from MO2-invs
Phenotype of all Fish created by or utilizing MO2-invs
Phenotype Fish Conditions Figures
whole organism curved ventral, abnormal AB/TU + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
post-vent region curved, abnormal WT + MO2-invs standard conditions Fig. S3 from Fukui et al., 2012
liver mislocalised, abnormal WT + MO2-invs standard conditions Fig. 3 from Zhou et al., 2010
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO2-invs standard conditions Fig. 3 from Zhou et al., 2010
opsin transport disrupted, abnormal WT + MO2-invs standard conditions Fig. 4 from Zhao et al., 2011
pancreas mislocalised, abnormal WT + MO2-invs standard conditions Fig. 3 from Zhou et al., 2010
liver development disrupted, abnormal WT + MO2-invs standard conditions Fig. 3 from Zhou et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO2-invs standard conditions Fig. 3 from Zhou et al., 2010
pronephros cystic, abnormal zf106Tg + MO2-invs standard conditions Fig. 7 from Burcklé et al., 2011
cloacal chamber deformed, abnormal zf106Tg + MO2-invs standard conditions Fig. 7 from Burcklé et al., 2011
pronephric glomerulus pronephric tubule increased diameter, abnormal nk20aEt; nkuasgfp1aTg + MO2-invs standard conditions Table1 from Fukui et al., 2012
heart looping process quality, abnormal nk20aEt; nkuasgfp1aTg + MO2-invs standard conditions Fig. S3 from Fukui et al., 2012
pronephric proximal convoluted tubule increased diameter, abnormal nk20aEt; nkuasgfp1aTg + MO2-invs standard conditions Table1 from Fukui et al., 2012
whole organism decreased length, abnormal AB/TU + MO1-dnaaf11 + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
presumptive rhombomere 5 increased width, abnormal AB/TU + MO1-dnaaf11 + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
somite increased width, abnormal AB/TU + MO1-dnaaf11 + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
convergent extension involved in gastrulation disrupted, abnormal AB/TU + MO1-dnaaf11 + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
whole organism curved ventral, abnormal AB/TU + MO1-dnaaf11 + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
presumptive rhombomere 3 increased width, abnormal AB/TU + MO1-dnaaf11 + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
whole organism decreased length, abnormal AB/TU + MO1-prickle1a + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
convergent extension involved in gastrulation disrupted, abnormal AB/TU + MO1-prickle1a + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
presumptive rhombomere 5 increased width, abnormal AB/TU + MO1-prickle1a + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
somite increased width, abnormal AB/TU + MO1-prickle1a + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
whole organism curved ventral, abnormal AB/TU + MO1-prickle1a + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
presumptive rhombomere 3 increased width, abnormal AB/TU + MO1-prickle1a + MO2-invs standard conditions Fig. 3 with image from Kishimoto et al., 2008
whole organism anterior-posterior axis curved, abnormal WT + MO1-ift70 + MO2-invs standard conditions Fig. 6 from Zhao et al., 2011
opsin transport disrupted, abnormal WT + MO1-ift70 + MO2-invs standard conditions Fig. 6 from Zhao et al., 2011
liver mislocalised, abnormal WT + MO1-nphp3 + MO2-invs standard conditions Fig. 3 from Zhou et al., 2010
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO1-nphp3 + MO2-invs standard conditions Fig. 3 from Zhou et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO1-nphp3 + MO2-invs standard conditions Fig. 3 from Zhou et al., 2010
pancreas mislocalised, abnormal WT + MO1-nphp3 + MO2-invs standard conditions Fig. 3 from Zhou et al., 2010
liver development disrupted, abnormal WT + MO1-nphp3 + MO2-invs standard conditions Fig. 3 from Zhou et al., 2010
neuromast hair cell disoriented, abnormal WT + MO1-vangl2 + MO2-invs standard conditions Fig. 7 from Zhao et al., 2011
establishment of planar polarity disrupted, abnormal WT + MO1-vangl2 + MO2-invs standard conditions Fig. 7 from Zhao et al., 2011
determination of left/right symmetry disrupted, abnormal WT + MO2-b9d2 + MO2-invs standard conditions Fig. 6 from Zhao et al., 2011
whole organism anterior-posterior axis curved, abnormal WT + MO2-b9d2 + MO2-invs standard conditions Fig. 6 from Zhao et al., 2011
opsin transport disrupted, abnormal WT + MO2-b9d2 + MO2-invs standard conditions Fig. 6 from Zhao et al., 2011
whole organism anterior-posterior axis curved, abnormal WT + MO2-ift52 + MO2-invs standard conditions Fig. 6 from Zhao et al., 2011
heart looping process quality, abnormal WT + MO2-invs + MO3-nek8 standard conditions Fig. 4 from Fukui et al., 2012
heart looping absent, abnormal WT + MO2-invs + MO3-nek8 standard conditions Fig. 4 from Fukui et al., 2012
pronephric glomerulus cystic, abnormal WT + MO2-invs + MO3-nek8 standard conditions Fig. 4 from Fukui et al., 2012
cloacal chamber deformed, abnormal zf106Tg + MO1-nphp4 + MO2-invs standard conditions Fig. 7 from Burcklé et al., 2011
pronephros cystic, abnormal zf106Tg + MO1-nphp4 + MO2-invs standard conditions Fig. 7 from Burcklé et al., 2011
cloacal chamber cell increased height, abnormal zf106Tg + MO1-nphp4 + MO2-invs standard conditions Fig. 7 from Burcklé et al., 2011
cloacal chamber cell increased amount, abnormal zf106Tg + MO1-nphp4 + MO2-invs standard conditions Fig. 7 from Burcklé et al., 2011
Citations