Morpholino

MO2-itga7

ID
ZDB-MRPHLNO-080930-2
Name
MO2-itga7
Previous Names
  • integrin a7-splice MO (1)
Target
Sequence
5' - CTCAGATCAGTGCAGACTCACCAGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-itga7
No data available
Phenotype
Phenotype resulting from MO2-itga7
Phenotype of all Fish created by or utilizing MO2-itga7
Phenotype Fish Conditions Figures
whole organism paralysed, abnormal WT + MO2-itga7 standard conditions Fig. 3 with image from Postel et al., 2008
locomotion involved in locomotory behavior decreased rate, abnormal WT + MO2-itga7 standard conditions Fig. 8 with image from Goody et al., 2012
skeletal muscle cell actin cytoskeleton retracted, abnormal WT + MO2-itga7 standard conditions Fig. 3 with image from Postel et al., 2008
myotome muscle cell detached from myotome muscle tendon junction, abnormal WT + MO2-itga7 standard conditions Fig. 3 with imageFig. 7 with image from Goody et al., 2012
locomotion involved in locomotory behavior decreased rate, abnormal WT + MO2-itga7 chemical treatment: NAD(+) Fig. 8 with image from Goody et al., 2012
myotome muscle cell degenerate, abnormal WT + MO1-dag1 + MO2-itga7 chemical treatment: NAD(+) Fig. 3 with image from Goody et al., 2012
myotome muscle cell degenerate, abnormal WT + MO1-dag1 + MO2-itga7 standard conditions Fig. 3 with image from Goody et al., 2012
myotome muscle tendon junction malformed, abnormal WT + MO1-dag1 + MO2-itga7 chemical treatment: NAD(+) Fig. 3 with image from Goody et al., 2012
vertical myoseptum malformed, abnormal WT + MO1-dag1 + MO2-itga7 standard conditions Fig. 3 with image from Goody et al., 2012
myotome muscle cell detached from myotome muscle tendon junction, abnormal WT + MO1-dag1 + MO2-itga7 standard conditions Fig. 3 with image from Goody et al., 2012
vertical myoseptum malformed, abnormal WT + MO1-dag1 + MO2-itga7 chemical treatment: NAD(+) Fig. 3 with image from Goody et al., 2012
myotome muscle tendon junction malformed, abnormal WT + MO1-dag1 + MO2-itga7 standard conditions Fig. 3 with image from Goody et al., 2012
myotome muscle cell detached from myotome muscle tendon junction, abnormal WT + MO1-dag1 + MO2-itga7 chemical treatment: NAD(+) Fig. 3 with image from Goody et al., 2012
myotome muscle cell detached from myotome muscle tendon junction, abnormal mai1Tg + MO2-itga7 standard conditions Fig. 7 with image from Goody et al., 2012
locomotion involved in locomotory behavior decreased rate, abnormal mai1Tg + MO2-itga7 standard conditions Fig. 8 with image from Goody et al., 2012
skeletal muscle cell sarcolemma retracted, abnormal vu119Tg + MO2-itga7 standard conditions Fig. S5 with image from Postel et al., 2008
skeletal muscle cell actin cytoskeleton retracted, abnormal vu119Tg + MO2-itga7 standard conditions Fig. S5 with image from Postel et al., 2008
Citations