Morpholino

MO2-hand2

ID
ZDB-MRPHLNO-080930-4
Name
MO2-hand2
Previous Names
None
Target
Sequence
5' - CCTCCAACTAAACTCATGGCGACAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-hand2
No data available
Phenotype
Phenotype resulting from MO2-hand2
Phenotype Fish Figures
atrium decreased size, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
atrium shape, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
cardiac muscle cell organization quality, abnormal WT + MO2-hand2 Fig. S7 with image from Hinits et al., 2012
cardiac muscle cell differentiation disrupted, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
cardiac ventricle decreased size, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
cardiac ventricle shape, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
cell migration to the midline involved in heart development delayed, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
cell migration to the midline involved in heart development process quality, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
embryonic heart tube elongation disrupted, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
enteric nervous system neuron decreased amount, abnormal WT + MO2-hand2 Fig. 2 with image from Reichenbach et al., 2008
enteric nervous system development disrupted, abnormal WT + MO2-hand2 Fig. 1 with image from Reichenbach et al., 2008
heart morphology, abnormal AB + MO2-hand2 Fig. 5 with image from Maves et al., 2009
heart development disrupted, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
heart formation disrupted, abnormal WT + MO2-hand2 Fig. S7 with image from Hinits et al., 2012
heart looping disrupted, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
heart morphogenesis disrupted, abnormal AB + MO2-hand2 Fig. 5 with image from Maves et al., 2009
heart morphogenesis process quality, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
heart primordium unfused from heart primordium, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
heart primordium myocardial precursor decreased amount, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
heart rudiment bifurcated, abnormal WT + MO2-hand2 Fig. S7 with image from Hinits et al., 2012
heart tube aplastic, abnormal AB + MO2-hand2 Fig. 4 with image from Maves et al., 2009
intestine neuron decreased amount, abnormal WT + MO2-hand2 Fig. 2 with image from Reichenbach et al., 2008
intestine smooth muscle cell morphology, abnormal WT + MO2-hand2 Fig. 1 with image from Reichenbach et al., 2008
neural crest cell migration disrupted, abnormal WT + MO2-hand2 Fig. 1 with image from Reichenbach et al., 2008
pronephric podocyte wnt2ba expression increased distribution, abnormal WT + MO2-hand2 Figure 6 with image from Drummond et al., 2022
pronephric podocyte wt1b expression increased distribution, abnormal WT + MO2-hand2 Figure 6 with image from Drummond et al., 2022
pronephric tubule wnt2ba expression increased distribution, abnormal WT + MO2-hand2 Figure 6 with image from Drummond et al., 2022
smooth muscle cell differentiation disrupted, abnormal WT + MO2-hand2 Fig. 1 with image from Reichenbach et al., 2008
Phenotype of all Fish created by or utilizing MO2-hand2
Phenotype Fish Conditions Figures
heart morphogenesis process quality, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
cardiac muscle cell differentiation disrupted, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
cardiac ventricle shape, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
heart development disrupted, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
heart tube aplastic, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
heart primordium myocardial precursor decreased amount, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
cell migration to the midline involved in heart development process quality, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
heart morphology, abnormal AB + MO2-hand2 standard conditions Fig. 5 with image from Maves et al., 2009
embryonic heart tube elongation disrupted, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
atrium shape, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
atrium decreased size, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
heart morphogenesis disrupted, abnormal AB + MO2-hand2 standard conditions Fig. 5 with image from Maves et al., 2009
cell migration to the midline involved in heart development delayed, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
heart primordium unfused from heart primordium, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
heart looping disrupted, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
cardiac ventricle decreased size, abnormal AB + MO2-hand2 standard conditions Fig. 4 with image from Maves et al., 2009
pronephric podocyte wt1b expression increased distribution, abnormal WT + MO2-hand2 control Figure 6 with image from Drummond et al., 2022
pronephric tubule wnt2ba expression increased distribution, abnormal WT + MO2-hand2 control Figure 6 with image from Drummond et al., 2022
intestine smooth muscle cell morphology, abnormal WT + MO2-hand2 standard conditions Fig. 1 with image from Reichenbach et al., 2008
intestine neuron decreased amount, abnormal WT + MO2-hand2 standard conditions Fig. 2 with image from Reichenbach et al., 2008
enteric nervous system neuron decreased amount, abnormal WT + MO2-hand2 standard conditions Fig. 2 with image from Reichenbach et al., 2008
heart formation disrupted, abnormal WT + MO2-hand2 standard conditions Fig. S7 with image from Hinits et al., 2012
neural crest cell migration disrupted, abnormal WT + MO2-hand2 standard conditions Fig. 1 with image from Reichenbach et al., 2008
enteric nervous system development disrupted, abnormal WT + MO2-hand2 standard conditions Fig. 1 with image from Reichenbach et al., 2008
smooth muscle cell differentiation disrupted, abnormal WT + MO2-hand2 standard conditions Fig. 1 with image from Reichenbach et al., 2008
heart rudiment bifurcated, abnormal WT + MO2-hand2 standard conditions Fig. S7 with image from Hinits et al., 2012
cardiac muscle cell organization quality, abnormal WT + MO2-hand2 standard conditions Fig. S7 with image from Hinits et al., 2012
pronephric podocyte wnt2ba expression increased distribution, abnormal WT + MO2-hand2 control Figure 6 with image from Drummond et al., 2022
pronephric podocyte wt1b expression spatial pattern, ameliorated osr1zf3911/zf3911 + MO2-hand2 control Figure 6 with image from Drummond et al., 2022
pronephric tubule wnt2ba expression spatial pattern, ameliorated osr1zf3911/zf3911 + MO2-hand2 control Figure 6 with image from Drummond et al., 2022
pronephric podocyte wnt2ba expression spatial pattern, ameliorated osr1zf3911/zf3911 + MO2-hand2 control Figure 6 with image from Drummond et al., 2022
heart morphology, abnormal AB + MO1-pbx2 + MO2-hand2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 5 with image from Maves et al., 2009
heart primordium unfused from heart primordium, abnormal AB + MO1-pbx2 + MO2-hand2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 5 with image from Maves et al., 2009
heart morphogenesis disrupted, abnormal AB + MO1-pbx2 + MO2-hand2 + MO2-pbx2 + MO2-pbx4 + MO3-pbx4 standard conditions Fig. 5 with image from Maves et al., 2009
Citations