Morpholino

MO1-mir9

ID
ZDB-MRPHLNO-081013-4
Name
MO1-mir9
Previous Names
  • dre-mir-9 MO (1)
  • MO1-mirn9 (1)
Targets
Sequence
5' - TCATACAGCTAGATAACCAAAGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
View all 7 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mir9
No data available
Phenotype
Phenotype resulting from MO1-mir9
No data available
Phenotype of all Fish created by or utilizing MO1-mir9
Phenotype Fish Conditions Figures
midbrain hindbrain boundary increased length, abnormal AB + MO1-mir9 standard conditions Fig. 6 from Leucht et al., 2008
midbrain hindbrain boundary increased width, abnormal AB + MO1-mir9 standard conditions Fig. 6 from Leucht et al., 2008
telencephalon ventricular zone her4.1 expression decreased amount, abnormal AB + MO1-mir9 control Fig. 3 with image from Katz et al., 2016
neuron differentiation disrupted, abnormal AB + MO1-mir9 standard conditions Fig. 7 from Leucht et al., 2008
brain onecut2 expression increased amount, abnormal WT + MO1-mir9 standard conditions Fig. S4 with image from Madelaine et al., 2017
hindbrain lateral region has extra parts of type neuron, abnormal WT + MO1-mir9 standard conditions Fig. 3 with image from Coolen et al., 2012
brain onecutl expression increased amount, abnormal WT + MO1-mir9 standard conditions Fig. S4 with image from Madelaine et al., 2017
retina nr2e1 expression increased amount, abnormal WT + MO1-mir9 standard conditions Fig. S4 with image from Madelaine et al., 2017
brain vegfaa expression increased amount, abnormal WT + MO1-mir9 standard conditions Fig. 2 with image,  Fig. 3 with image from Madelaine et al., 2017
hindbrain exit from mitosis delayed, abnormal WT + MO1-mir9 standard conditions Fig. 3 with image from Coolen et al., 2012
hindbrain cell proliferation in hindbrain ventricular zone increased occurrence, abnormal WT + MO1-mir9 standard conditions Fig. 2 with image from Coolen et al., 2012
retina onecut1 expression increased amount, abnormal WT + MO1-mir9 standard conditions Fig. S4 with image from Madelaine et al., 2017
brain onecut1 expression increased amount, abnormal WT + MO1-mir9 standard conditions Fig. S4 with image from Madelaine et al., 2017
retina vegfaa expression increased amount, abnormal WT + MO1-mir9 standard conditions Fig. 2 with image from Madelaine et al., 2017
hindbrain neurogenesis increased occurrence, abnormal WT + MO1-mir9 standard conditions Fig. 3 with image from Coolen et al., 2012
retina onecut2 expression increased amount, abnormal WT + MO1-mir9 standard conditions Fig. S4 with image from Madelaine et al., 2017
retina onecutl expression increased amount, abnormal WT + MO1-mir9 standard conditions Fig. S4 with image from Madelaine et al., 2017
hindbrain neurogenesis increased duration, abnormal WT + MO1-mir9 standard conditions Fig. 3 with image from Coolen et al., 2012
brain nr2e1 expression increased amount, abnormal WT + MO1-mir9 standard conditions Fig. S4 with image from Madelaine et al., 2017
brain vegfaa expression amount, ameliorated WT + MO1-mir9 + MO1-nr2e1 + MO1-onecutl standard conditions Fig. 3 with image from Madelaine et al., 2017
hindbrain lateral region has extra parts of type neuron, abnormal knu3Tg + MO1-mir9 standard conditions Fig. 3 with image from Coolen et al., 2012
hindbrain neurogenesis increased occurrence, abnormal knu3Tg + MO1-mir9 standard conditions Fig. 3 with image from Coolen et al., 2012
primordial hindbrain channel increased thickness, abnormal la116Tg + MO1-mir9 standard conditions Fig. 2 with image from Madelaine et al., 2017
central artery vascular sprouts increased amount, abnormal la116Tg + MO1-mir9 standard conditions Fig. 2 with image from Madelaine et al., 2017
primordial hindbrain channel endothelial cell increased amount, abnormal la116Tg + MO1-mir9 standard conditions Fig. 2 with image from Madelaine et al., 2017
dorsal telencephalon neuronal stem cell division increased occurrence, abnormal mi2001Tg + MO1-mir9 standard conditions Fig. 2 with image from Katz et al., 2016
dorsal telencephalon stem cell proliferation increased occurrence, abnormal mi2001Tg + MO1-mir9 standard conditions Fig. 2 with image from Katz et al., 2016
radial glial cell nucleus Ab1-ago labeling decreased amount, abnormal mi2001Tg + MO1-mir9 control Fig. 4 with image from Katz et al., 2016
primordial hindbrain channel increased thickness, abnormal s896Tg + MO1-mir9 control Fig. 2 with image from Madelaine et al., 2017
central artery vascular sprouts disorganized, abnormal s896Tg + MO1-mir9 control Fig. 2 with image from Madelaine et al., 2017
central artery vascular sprouts decreased amount, abnormal s896Tg + MO1-mir9 control Fig. 2 with image from Madelaine et al., 2017
central artery decreased thickness, abnormal s896Tg + MO1-mir9 control Fig. 2 with image from Madelaine et al., 2017
middle mesencephalic central artery malformed, abnormal s896Tg + MO1-mir9 control Fig. 2 with image from Madelaine et al., 2017
hindbrain blood vessel malformed, abnormal s896Tg + MO1-mir9 control Fig. 2 with image from Madelaine et al., 2017
central artery vascular sprouts amount, ameliorated s896Tg + MO1-mir9 chemical treatment by environment: semaxanib Fig. 2 with image from Madelaine et al., 2017
retina blood vessel decreased amount, abnormal s896Tg + MO1-mir9 standard conditions Fig. 6 with image from Madelaine et al., 2018
hyaloid vessel malformed, abnormal s896Tg + MO1-mir9 standard conditions Fig. 6 with image from Madelaine et al., 2018
brain blood vessel malformed, abnormal s896Tg + MO1-mir9 control Fig. 2 with image from Madelaine et al., 2017
central artery disorganized, abnormal s896Tg + MO1-mir9 control Fig. 2 with image from Madelaine et al., 2017
retina blood vessel malformed, abnormal s896Tg + MO1-mir9 control Fig. 2 with image from Madelaine et al., 2017
Citations